Just as a time expression
Vcd as a stimulating factor to increase the young learners’ time-on-task
... he also makes a distinction between task-based teaching and task-supported teaching. The task-based teaching occurs when the teaching is based exclusively on meaning-focus tasks, and the task-supported ... general, with VCDs pupils time-on-task was around 70% of the class-time against 45% of the class-time in case of audiocassettes used. Languages are not fixed but constantly changing, so is the ... notional-functional approach, and the communicative approach, which are based on the three above language theories, respectively.According to Ellis (2005), the oral-situational approach is based...
- 45
- 516
- 0
Báo cáo khoa học: "Lexical surprisal as a general predictor of reading time" potx
... for Computational LinguisticsLexical surprisal as a general predictor of reading timeIrene Fernandez Monsalve, Stefan L. Frank and Gabriella ViglioccoDivision of Psychology and Language SciencesUniversity ... psychological accu-racy of each model (χ2(2) values) plotted againstits linguistic accuracy (i.e., its quality as a lan-guage model, measured by the negative aver-age surprisal on the experimental ... frequency, a baseline regressionmodel taking them into account was built. Subse-quently, the decrease in the model’s deviance, af-ter the inclusion of surprisal as a fixed factor to thebaseline, was...
- 11
- 605
- 0
Silicon as a model ion trap: Time domain measurements of donor Rydberg states
... transitions.10652͉www.pnas.org͞cgi͞doi͞10.1073͞pnas.0802721105 Vinh et al. Silicon as a model ion trap: Time domain measurements of donor Rydberg states N. Q. Vinh*, P. T. Greenland†, K. Litvinenko‡, ... scales10–100 times faster than what is usual in atoms. Our time- domain dat a show directly that population decay ef fects arethe dominant contribution to frequenc y -domain linewidths of Rydberg levels ... –12915.19. Halsall MP, Harrison P, Wells J-PR, Bradley IV, Pellemans H (2001) Picosecond far-infrared studies of intra-acceptor dynamics in bulk GaAs and␦-doped AlAs/GaAsquantum wells. Phys...
- 5
- 296
- 0
Báo cáo khoa học: Homologous expression of a bacterial phytochrome The cyanobacterium Fremyella diplosiphon incorporates biliverdin as a genuine, functional chromophore doc
... (5Â-TATACCATGGGCTTAAGTCCTGAAAATTCTCCAG-3Â) and oBQ147(5Â-AAACTCGAGCCGGCCCTCAATTTTGACCTCCTGCAATGTGAAATAGAACG-3Â), and cloned between the NcoI and XhoI sites into pET2 8a( +), providing a His-tag ... we aimed at the identification of a chromophore that is incor-porated in vivo into cyanobacterial phytochrome B within the cyanobacte-rial cell. The approach was based on the introduction of a ... 5Â-CACTCGGTACTCCGCAGCGTTTCGCCGTTARCCATTGAATATTTGCACAATATGG-3Â (R ẳ purine); and oBQ145-2,5Â-CCATATTGTGCAAATATTCAATGGYTAACGGCGAAACGCTGCGGAGTACCGAGTG-3Â (Y ẳ pyrimidine). The differences from the wild-type sequence are indicated. The mutations...
- 11
- 440
- 0
báo cáo hóa học:" Aberrant expression and potency as a cancer immunotherapy target of alpha-methylacyl-coenzyme A racemase in prostate cancer" pptx
... hepatic cancer, colon cancer and lung cancer. Immunostaining of prostate cancer tissue with antibodies against AMACR and PSAFigure 2Immunostaining of prostate cancer tissue with antibodies against ... mRNA in prostate cancer line LNCaP, but only very weak expression of AMACR mRNA was observed in normal adult liver and pancreas (Figure 1A) . In contrast, the AMACR mRNA levelwas elevated in all ... AbstractAlpha-methylacyl-CoA racemase (AMACR) is an enzyme playing an important role in the beta-oxidation of branched-chain fatty acids and fatty acid derivatives. High expression levels of...
- 11
- 531
- 0
Báo cáo hóa học: "IThe tumor microenvironment of colorectal cancer: stromal TLR-4 expression as a potential prognostic marker" potx
... 102:908-915.doi:10.1186/1479-5876-8-112Cite this article as: Cammarota et al.: The tumor microenvironment of colorectal cancer: stromal TLR-4 expression as a potential prognostic marker. Journal of Translational Medicine 2010 ... Open AccessThe tumor microenvironment of colorectal cancer: stromal TLR-4 expression as a potential prognostic markerRosaria Cammarota1, Valentina Bertolini2, Giuseppina Pennesi1, Eraldo ... with an increased expression with advancing disease, TLR-4 expression was associatedwith different survival of patients with invasive colonAC. We observed that AC patients who had a percen-tage...
- 16
- 217
- 0
Báo cáo sinh học: "CGB and GNRH1 expression analysis as a method of tumor cells metastatic spread detection in patients with gynecological malignances" potx
... may indicate patients in metastasis stage. Analysis of results demonstrated that in part of thestudied blood samples of cancer patients activity of CGB and GNRH1 wasonthesamelevelasincontrolgroup.There ... method of tumor cells metastatic spread detection in patients with gynecological malignances. Journal of TranslationalMedicine 2011 9:130.Andrusiewicz et al. Journal of Translational Medicine ... CGB and GNRH1 expression (Table 3) as well as clinical data (Table 4) in studied tis-sues and blood was observed.DiscussionThe critical role of circulating tumor cells in metastatic spread of...
- 9
- 460
- 0
Báo cáo toán học: " Music expression with a robot manipulator used as a bidirectional tangible interface" pptx
... performanceWe collaborated with K [36], a promising musician, to prove the capabilities of the robot arm when used as a compliant tangible music interface. Together with theartist, we created a ... movetowards a virtual attractor in 3D Cartesian space as if its dynamics was equivalentto a virtual mass concentrated in its end-effector and attached by a virtual springand damper.We propose ... as the modulation refinementproceeds. This article reports early results of an artistic performance that has beencarried out with the collaboration of a musician, who played with the robot as...
- 34
- 323
- 0
báo cáo hóa học:" Music expression with a robot manipulator used as a bidirectional tangible interface" potx
... Email addresses: Music expression with a robot manipulator used as a bidirectional tangible interfaceVictor Zappi∗, Antonio Pistillo, Sylvain Calinon,Andrea Brogni and Darwin CaldwellDepartment ... has been extended with music mappings, as explained laterin this section.The robot is used as a haptic interface to create low frequency oscillators andautomations, and as a remotely operated ... J Solis, A Takanishi, Musical-based interaction system for the Waseda Flutist Robot. Autonomous Robots 28(4), 471–488 (2010)3. A Kapur, M Darling, A Pedagogical Paradigm for Musical Robotics,...
- 34
- 183
- 0
Báo cáo y học: "Metalloproteinase and inhibitor expression profiling of resorbing cartilage reveals pro-collagenase activation as a critical step for collagenolysis" pot
... activation and aggrecan and collagen release.Materials and methods Cartilage degradation assayBovine nasal cartilage was cultured as previously described[20]. Briefly, bovine nasal septum cartilage ... ATATTTATACGCCTTTTGATTCCT 297GGTACCCGTAGAGCTTCCGTTCCα2M GCCCGCTTTGCCCCTAACA 359TCGTCCACCCCACCCTTGATGRECK GTAATTGCCAAAAAGTGAAA 352TAGGTGCATATAAACAAGAAGTAADAMTS-1 GCTGCCCTCACACTGCGGAAC 264CATCATGGGGCATGTTAAACACADAMTS-4 ... 287AATAGCTTTACGGGTTTCAGGTIMP-1 TGGGCACCTGCACATCACC 277CATCTGGGCCCGCAAGGACTGTIMP-2 ATAGTGATCAGGGCCAAAGCAGTC 277TGTCCCAGGGCACGATGAAGTCTIMP-3 GATGTACCGAGGATTCACCAAGAT 356GCCGGATGCAAGCGTAGTTIMP-4 ATATTTATACGCCTTTTGATTCCT...
- 12
- 526
- 0
Báo cáo khoa học: "Tumor slices as a model to evaluate doxorubicin in vitro treatment and expression of trios of genes PRSS11, MTSS1, CLPTM1 and PRSS11, MTSS1, SMYD2 in canine mammary gland cancer" pptx
... Veterinaria ScandinavicaOpen AccessResearchTumor slices as a model to evaluate doxorubicin in vitro treatment and expression of trios of genes PRSS11, MTSS1, CLPTM1 and PRSS11, MTSS1, SMYD2 in ... in canine mammary gland cancerRenata A Sobral1, Suzana T Honda1, Maria Lucia H Katayama1, Helena Brentani2, M Mitzi Brentani1, Diogo FC Patrão2 and Maria Aparecida AK Folgueira*1Address: ... http://www.actavetscand.com/content/50/1/27Page 3 of 9(page number not for citation purposes)Patients were evaluated by clinical history and physicalexamination including mammary tumor measurement and inguinal and axillary nodes palpation,...
- 9
- 337
- 0
Báo cáo y học: " APOBEC3G-UBA2 fusion as a potential strategy for stable expression of APOBEC3G and inhibition of HIV-1 replication" pot
... 5' primer used was 5'-ATCCAAGACGGAATTCACGCCGCAGGAGAAA-GAAGCTATAG-3'; the 3' primer for the APOPEC3G-UBA2 fusion was 5'-ATCGTACTCGAAGCTTCTAACTCAGGAG-GAAGTTGGCAG-3'; ... AccessResearch APOBEC3G- UBA2 fusion as a potential strategy for stable expression of APOBEC3G and inhibition of HIV-1 replicationLin Li1,4, Dong Liang1, Jing-yun Li4 and Richard Y Zhao*1,2,3,4Address: ... protein band because it only reacts to certain batches of anti -APOBEC3G antibody. To elimi-nate this background, the protein intensity of APOBEC3G- UBA2 and APOBEC3G- UBA2* was calculated by subtracting...
- 13
- 254
- 0
performance of robust controller for dfim when the rotor angular speed is treated as a time-varying parameter
... the mechanical angular speed is eliminated by adding a feed-forward term to the output of the q-axis controller [2], [5]. The rotor mechanical angular speed is treated as an scheduling parameter ... changing of the rotor angular speed. In that sense, the rotor angular speed can be adopted as a gain-scheduling parameter. Tài liệu tham khảo [1] G. Tapia A. Tapia and J. X. Ostolaza. Reactive ... investigated. The performance analysis is also extended for the case with the face of the stator voltage action. As a further investigation, the designed controller for a frozen values of is tested...
- 10
- 336
- 0
Just as a time expression
... Just as a time expression Just is one of the commonest words in English. It has many uses. Just as a time expression Just can be a time expression. In this case, it is mainly used ... called.I just received a call from your Dad.She just left.I just finished the report. As a time expression, just means recently. Just can also mean immediately or in an instant. In this case, ... the expressions just after, just before, just as and just when. Just as I closed my eyes, I heard a loud noise.She always comes just when I am ready to leave.I thought about it just...
- 1
- 174
- 0
Từ khóa: Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ