0
  1. Trang chủ >
  2. Giáo án - Bài giảng >
  3. Tiếng anh >

cach dung " another-other-the other- others and the others "

Cách Dùng THE OTHER - OTHER - ANOTHER THE OTHERS - OTHERS pptx

Cách Dùng THE OTHER - OTHER - ANOTHER THE OTHERS - OTHERS pptx

... like this book I like the others = ( I like the other books ) Lưu ý có đối tượng đối tượng dùng ONE đối tượng thư dùng THE OTHER I have brothers One is a doctor, and the other is a teacher Tôi ... I have brothers One is a doctor ; the others are teachers Tôi có người anh Một ngừoi bác sĩ ngừoi lại giáo viên The others = The other + N số nhiều There are books on the table I don't ... không? ( để định dùng the hay không ) • Số hay số nhiều? ( để định dùng another hay other ) • Phía sau có danh từ hay không ? ( để phòng danh từ số nhiều dùng other không dùng others) ...
  • 2
  • 779
  • 5
Other another and others exercise

Other another and others exercise

... each other very much Where are the other boys? He never thinks of others We will be staying for another few weeks They sat for hours looking into one another s eyes 10 They talk to each other...
  • 2
  • 1,369
  • 5
Đề tài NCKH: Tính triết lý trong sáng tạo hội họa thể hiện qua cách dùng bút

Đề tài NCKH: Tính triết lý trong sáng tạo hội họa thể hiện qua cách dùng bút

... trị, tài tác giả qua cách sử dụng bút, mực - Ý niệm, triết sống thể qua cách sử dụng bút sáng tạo nghệ thuật - Làm rõ ảnh hưởng qua lại nghệ thuật phương Đông phương Tây qua cách sử dụng bút ... ngoạn nhìn sắc bén tư duy, triết sáng tạo họa sĩ Thông qua đề tài, tác giả mong muốn đóng góp phần luận phương pháp thể bút, làm tiền đề cho giảng dạy nghệ thuật sáng tạo nghệ thuật, góp thêm ... pháp sáng tạo nghệ thuật, tác động lớn cho nhận thức thẩm mỹ đại chúng Trong phương pháp dùng bút sáng tạo nghệ thuật, tạo dựng cho nghệ thuật nhiều quan điểm, triết sáng tạo khác Ngọn bút không...
  • 17
  • 1,033
  • 12
5 cách kiểm soát mụn bạn có thể sử dụng ngay hôm nay

5 cách kiểm soát mụn bạn có thể sử dụng ngay hôm nay

... chân lông kích ứng da gây nên mụn trứng cá bạn sử dụng sản phẩm mỹ phẩm nhãn “noncomedogenic” cung cấp nhiều độ ẩm cho da Những loại mỹ phẩm khác khiến khuôn mặt bạn trở nên lung linh chứa mica ... uống không đóng vai trò nguyên nhân việc gây mụn điều trị mụn Tuy nhiên, khuyến khích cho trình chăm sóc, phòng ngừa mụn trứng cá Bạn nên ăn tốt cho thể tốt cho da Vì vậy, để ý chế độ ăn uống khỏe ... đắn Cạo lông Là cách tuyệt vời để tẩy tế bào chết loại bỏ da chết giúp ngăn chặn lây lan mụn thay để làm tắc nghẽn lỗ chân lông Đối với số trường hợp, cạo lông giúp loại bỏ mụn mụn đầu đen từ...
  • 4
  • 387
  • 0
Levinas and the face of the other

Levinas and the face of the other

... past, the trace of the other marks and even constitutes the other s face The high presence of the face- to -face yields to the ritardando of a mere after -face The other enters through a back-door Levinas ... pieces, the face of the other plays a central role The glean of exteriority or of transcendence’ happens ‘in the face of the Other (ti 24), requiring a new ‘thinking in the face of the Other ... Levinas and the face of the other 71 We can certainly contradict what the other says because the other is not a dogmatic authority, but we cannot contradict the call and demand of the other s face which...
  • 19
  • 450
  • 0
A study on differences of using pasive voi in english and vietnamese = nghiên cứu về sự khác nhau trong cách dùng câu bị động của tiếng anh và tiếng việt luận văn tốt nghiệp đại học

A study on differences of using pasive voi in english and vietnamese = nghiên cứu về sự khác nhau trong cách dùng câu bị động của tiếng anh và tiếng việt luận văn tốt nghiệp đại học

... translation of passive causatives) 3.2 Implications for English teaching and learning of passive voice So far, we have come to conclusion that Vietnamese passive formation is mainly based on ... A recommendation for approval or rejection is made to the Australian and New Zealand Food Standards Council (consisting of the Health Ministers of Australia and New Zealand) should not be translated ... not always satisfactory, Vietnamese learners, competent in grammar and vocabulary as they are, still make mistakes In English language, passive voice is acknowledged and used as a grammar point...
  • 46
  • 1,424
  • 6
Credit Growth and the Effectiveness of Reserve Requirements and Other Macroprudential Instruments in Latin America pdf

Credit Growth and the Effectiveness of Reserve Requirements and Other Macroprudential Instruments in Latin America pdf

... borrowing.2 A summary of the recent use of macroprudential measures in Latin America is reported in Table Despite their increasing use, the effectiveness of macroprudential policies in leaning against ... measure the changes in RRs and in other macroprudential policies Our findings indicate that RRs and other macroprudential policies lead to a moderate and transitory slowdown in the growth of bank credit ... “lean against the wind”: (i) raising RRs during the upswing phase of the cycle to contain excessive credit growth and the associated build up of vulnerabilities and (ii) lowering them during the downswing...
  • 29
  • 525
  • 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... be other meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal helix, but not the b domain The distinguishing feature of members of the meiotic clade of AAA ATPases is the ... Role of the Vps4 C-terminal helix Fig 11 A C-terminal helix is a characteristic feature of meiotic clade AAA ATPases Sequence alignments of some of the proteins listed in the PFAM database that...
  • 23
  • 490
  • 0
The comma và cách dung pptx

The comma và cách dung pptx

... clauses are brief and the sentence can be read easily without the comma, it can be omitted In 1649(,) the settlers abandoned their initial outpost Dùng dấu phẩy tính từ The designs for an expensive, ... Anxious about the upcoming winter, settlers began to bicker among themselves about supplies In the winter of 1644, nearly half the settlers died of starvation or exposure * If the adverbs or ... ice.” “Fire when ready, Gridley,” the Admiral said “We can’t see into the future,” said the President, “but we have to prepare for it nonetheless.” Dùng dấu phẩy parenthetical elements (cụm từ bổ...
  • 6
  • 318
  • 0

Xem thêm

Từ khóa: cách sử dụng another other otherscách dùng quán từ a an thecách dùng mạo từ a an thebài tập về cách dùng mạo từ a an thecách dùng mạo từ a an the trong tiếng anhcách dùng in other wordscách dùng each other và one anothercách dùng nucleus kernel fat and ntfscách dùng hàm if và and trong excelcách dùng hàm if và and trong excel 2007cách dùng hàm if và andcách dùng mạo từ xác định theother appropriated and the other rejectedcách sử dụng other otherscách dùng other và othersMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ