luận văn Toxicity assessment of small molecules using the zebrafish as a model system
luận văn Toxicity assessment of small molecules using the zebrafish as a model system
... decreased as they adapted to darkness The habituation effect can also be seen as the decrease of active time toward the end of the dark phases, though the point of reaching maximal activity varied ... CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix SYBR Hi-ROX Kit (Bioline; Meridian Life Science) and the reaction ... contributed to the dramatic boost in the distance that larvae moved in the dark Larvae responded to the onset of darkness with a strong startle, causing a maximal peak on the speed actogram, then their...
- 58
- 262
- 0
báo cáo hóa học:" Assessing normative cut points through differential item functioning analysis: An example from the adaptation of the Middlesex Elderly Assessment of Mental State (MEAMS) for use as a cognitive screening test in Turkey" docx
... ascertain the validity of the instrument in different diagnostic groups Finally, the use of DIF as a basis for analysing bias in cut points is recommended as a routine assessment where clinical cut ... passing a subtest was made through Differential Item Functioning analysis within the framework of the Rasch model [13] This analysis pooled the data from the normal and patient groups where, in ... for the MEAMS, a formal test of the validity of the cut point is the absence of DIF For example, if a cut point is set for passing a subtest and DIF is present for that subtest by age, then further...
- 8
- 448
- 0
Báo cáo khoa học: "Solving Relational Similarity Problems Using the Web as a Corpus" potx
... verbal analogy problems, yielding 47% accuracy The same approach is applied to classifying noun-modifier pairs: using the Diverse dataset of Nastase and Szpakowicz (2003), Turney&Littman achieve ... 2.3 Paraphrase Acquisition Our method of extraction of paraphrasing verbs and prepositions is similar to previous paraphrase acquisition approaches Lin and Pantel (2001) extract paraphrases from ... for each of the six word pairs We then calculate the relational similarity between the stem of the analogy and each of the five candidates, and we choose the pair with the highest score; we make...
- 9
- 390
- 0
Báo cáo Y học: High pressure-induced changes of biological membrane Study on the membrane-bound Na+/K+-ATPase as a model system pdf
... mM NADH, lgámL)1 of pyruvate kinase, and 2.5 lgámL)1 LDH in a total volume of mL The reaction was initiated by an addition of 50 ng of Na+/K+-ATPase Na+-dependent ATPase activity was also measured ... be con®rmed that the Na+/K+-ATPase activity, as determined by the coupled assay system, increased linearly with an increase in the incubation time and enzyme concentration under a pressure of ... explained as a change in the Na+/K+ATPase-lipid bilayer system That is, a high pressure of 100± 220 MPa causes dissociation of a and b subunits, disassembly of transmembrane a helices, and a separation...
- 9
- 432
- 0
Báo cáo y học: " Status of complete proteome analysis by mass spectrometry: SILAC labeled yeast as a model system" ppt
... database This database was complemented with frequently observed contaminants (porcine trypsin, achromobacter lyticus lysyl endopeptidase and human keratins) A 'decoy database' was prepared by ... spectrum/spectrum matching using very fast scans and most importantly by increasing the dynamic range of the mass spectrometer by separately accumulating highly abundant peptides and low abundance peptides ... 8a) As both SILAC forms were of equal abundance, they were both recognized by the data system as candidates for sequencing The fact that in 40% of the cases, only one of them was actually fragmented...
- 15
- 267
- 0
Luận văn english prepositions of place at, on, in an analysis of errors made by secondary school students
... formal and standard English is in demands An analysis of errors in using prepositions of place AT, ON, IN is carried out to give the answer to the wondering question That whether the errors in using ... full analysis of errors in using prepositions of place at, on, in made by secondary school students The Error Analysis has proved that Vietnamese secondary students meet a lot of difficulties in ... therefore, errors in the learning process of English are inevitable The errors in using prepositions, especially the prepositions of place AT, ON, IN are not exceptional The teaching and learning of prepositions...
- 46
- 1,351
- 18
Tài liệu Báo cáo khoa học: The effect of small molecules in modulating the chaperone activity of aB-crystallin against ordered and disordered protein aggregation pdf
... effect on the chaperone activity of aB-crystallin against the DTT-induced aggregation and precipitation of insulin B C Fig aB-crystallin protects against the DTT-induced aggregation of insulin, ... increased the chaperone activity of aB-crystallin (84 ± 4%) against this target protein The effect of Arg-HCl on the structure and assembly of aB-crystallin We investigated whether the effects of these ... on the overall activity of chaperone proteins Of the target proteins tested, Arg-HCl was found to specifically increase the activity of aB-crystallin against DTT-induced precipitation of insulin...
- 13
- 613
- 0
Báo cáo hóa học: " Research Article Automated Intelligibility Assessment of Pathological Speech Using Phonological Features" potx
... L Shriberg, and J R Green, “Diagnostic assessment of childhood apraxia of speech using automatic speech recognition (ASR) methods,” Journal of Medical SpeechLanguage Pathology, vol 12, no 4, ... “Automatic scoring of the intelligibility in patients with cancer of the oral cavity,” in Proceedings of the 8th Annual Conference of the International Speech Communication Association (Interspeech ’07), ... frames of all utterances of one speaker, the speaker feature extractor can derive from these tuples (and from the canonical values of the phonological classes in the different states) a set of phonological...
- 9
- 161
- 0
Báo cáo lâm nghiệp: " Fungi associated with Tomicus piniperda in Poland and assessment of their virulence using Scots pine seedlings" doc
... above Fungi associated with Tomicus piniperda in Poland 803 Table I The results of the inoculation experiments with fungi associated with Tomicus piniperda on two-year-old plants Depth of sapwood ... associated with T piniperda was investigated by inoculating Scots pine seedlings MATERIALS AND METHODS In Mielec, 24 uninfested Scots pine trees were felled in early March In the other sampling locations ... Isolation of > 60 species of fungi from T piniperda galleries in Scots pine demonstrate that this beetle is associated with a great diversity of filamentous microfungi in Poland Ophiostomatoid fungi...
- 8
- 432
- 0
INHIBITION OF APE1’S DNA REPAIR ACTIVITY AS A TARGET IN CANCER: IDENTIFICATION OF NOVEL SMALL MOLECULES THAT HAVE TRANSLATIONAL POTENTIAL FOR MOLECULARLY TARGETED CANCER THERAPY
... IDENTIFICATION OF NOVEL SMALL MOLECULES THAT HAVE TRANSLATIONAL POTENTIAL FOR MOLECULARLY TARGETED CANCER THERAPY The DNA Base Excision Repair (BER) pathway repairs DNA damaged by endogenous and exogenous ... times and the long distances Thanks for always being there for me and for being my number #1 fan v ABSTRACT Aditi Ajit Bapat INHIBITION OF APE1’S DNA REPAIR ACTIVITY AS A TARGET IN CANCER: IDENTIFICATION ... Normal cells are proficient in all forms of DNA repair; however, deficiency of a particular DNA repair pathway in cancer cells can lead to elevated levels of other DNA repair pathway proteins leading...
- 156
- 218
- 0
landslide hazard and risk assessment for road network using rs and gis a case study of xin man district, vietnam
... in Xin Man Landcover in Xin Man Road system in Xin Man Landslide distribution in Xin Man district Landslide hazard zonation for buffer area in Xin Man Landslide hazard zonation for buffer area ... distance to road The hazard value ranges used for road buffer The hazard value ranges used for whole area % area for landslide hazard zone for buffer area % area for landslide hazard zone for ... Distance Landcover Independent data layers(categorical) DATA INTEGRATION Geological map Landslides map Lineament map Landslides map Elevation map Landslides map Slope map Landslides map Drainage...
- 142
- 465
- 1
Từ khóa: using the web as a corpus for the syntacticbased location identification835 using the 74x163 as a modulo 11 counter with the counting sequence 5 6 º 15 5 6 º836 using the 74x163 as a modulo 11 counter with the counting sequence 0 1 2 º 10 0in utero assessment of cardiovascular function in the embryonic mouse heart using high resolution ultrasound biomicroscopyassessment of topical bioequivalence using microdialysis and other techniquesii assessment of emotional responses using visual analog scale vasa thousand cuts an assessment of small boat grounding damage to shallow corals of the florida keysluận văn nghiên cứu lịch sử báo chí thế giớiusing the six thinking hats model of learning in a surgical nursing classarabic part of speech tagging using the sentence structureproblems of using english language as a medium of business communication in nigeriaproblems of using english language as a medium of business communicationadvantages of using case study as a teaching methodluan van bao cao dang lanh dao chu the kinh te trong kinh te tri thuong dinh huong xa hoi chu nghia o viet nam giai doan 1996 2006luận văn đánh giá chất lượng dịch vụ của khách sạn á châuBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP