Nonlinear connected oscillations of rigid bodies
Nonlinear connected oscillations of rigid bodies
... Nonlinear connected oscillations o f rigid bodies F ig 315 Connected Plane-Parallel Oscillations of a Rigid Body We consider the plane-parallel oscillations of a rigid body, that is such oscillations ... origin of the coordinates v-a-trV Fio q u a n tity Nonlinear connected oscillations o f rigid bodies 313 Comparing these curves, it can be seen that with a definite value of velocity of motion of ... resonance of the second kind (n = 2): CM2») Nonlinear connected oscillations o f rigid bodies ^09 and for n 7* , : da h From Eqs (3.8), it can be seen that when n 7^ 1, 2, the amplitude a of the oscillations...
- 32
- 197
- 0
Nonlinear oscillations of the third order systems. Part III Parametric oscillation
... Dao B \ contrast with the parametric oscillation in the well k n ow n second -order system , ie riiidity o f the nonlin ear system and the m ax im u m o f the am plitudes o f oscillation ĩr e te ... m= [ qm( a ) c o s m ( p + p m(a )s i nm (p ] , - / o + ữcos^ ccos Nonlinear oscillations o f the third order systems Part III 255 lere 2.71 q0 = — Ị f i a c o s q ) , — - y ứ s i n ọ ? , — ^ ... J|(i 2 - A - lls) f l + - ^ - / i S (2 c* = £C ÍP V y 2Q ■ J , 261 Nonlinear oscillations o f the third order systems Part III In F i e th e d e p e n d e n c e o f a0 o n is p r e s e n t e...
- 13
- 306
- 0
Nonlinear oscillations of third order systems. Part 1 Autonomous systems
... fu n c tio n s A l , B i, Uị f r o m (1 ), w c firs t e x p a n d R q in th e F o u r ie r series: Nonlinear oscillations o f third order systems Part I 513 00 ( ) [ g , ( a ) c o s « 9> + /i„(a)sin ... u a tio n o f the syste m (1 ) a s : (1. 14) (a ) dt Obviously, the stability condition of the stationary solution a = a0y &(ơ0) = (1. 14) is of the form: ' ( a o) < (1 ) The Duffing Case L e t ... Bl{a) - ■ E q u a t io n s (1 ) are o f the fo rm : (2 Ì ^ dt = _L/?*/7 _ dt ~ Q P ' " £ /?*ỵj2ứ* ( f a + f l a) ■ Nonlinear oscillations o f third order systems Part I 515 B y in te g tin g E q...
- 9
- 362
- 1
Nonlinear oscillations of third order systems. Part II Non-autonomous systems
... equation of the re sonance curve: (3.3) w h ere w e deno te (3 ) T h e firs t s ta b ility c o n d itio n (2 ) is o f the f o r m : - yp a l > , Nonlinear oscillations o f third order systems Part II ... purpose, we represent the solution of Eq (4.1) in the form: (5 ) X =* a0cos(yt + ip0)+ b Q o sQ t9 131 Nonlinear oscillations o f third order systems Part II w h ere the firs t term is the fo ... r the case J = /2 , ÍÌ = Ỉ = 1, e = are represented in F ig In th is Nonlinear oscillations o f third order systems Part II F ig u re , th e p lo t is a lso depicted o f the re sp o n se c u...
- 10
- 405
- 1
Parametric oscillations of dynamical systems with cubic term at the modulation depth under the influence of nonlinear frictions
... ACTA MATHEMATICA VIETNAMlCA TO M 3, N ° (1978) P aram etric oscillations of dynamical system s with cubic term at the modulation depth under the influence of nonlinear frictions N G U ... later the nonlinearity of the system under consider ation/coefficient a/stron gly influences to the maximum of am plitudes of stationary oscillations and their stability § T H E INFLUENCE OF ... National Institute of Sciences S R V T his paper deals w ith the influence of nonlinear frictions to the para metric oscillations of dynam ical system s described by the equation w ith the cubic...
- 15
- 292
- 0
Tài liệu Management of Dead Bodies after Disasters: A Field Manual for First Responders docx
... that accurate identification is achieved by evaluating a combination of criteria and not solely on visual recognition 13 Management of Dead Bodies after Disasters: A Field Manual for First Responders ... myth of epidemics caused by dead bodies will be appreciated Talk about this to your colleagues and members of the media 29 Management of Dead Bodies after Disasters: A Field Manual for First Responders ... separate the site from inhabited areas 21 Management of Dead Bodies after Disasters: A Field Manual for First Responders Distance from water sources o Burial sites should be at least 200m away...
- 58
- 450
- 2
Tài liệu Báo cáo Y học: The effects of low pH on the properties of protochlorophyllide oxidoreductase and the organization of prolamellar bodies of maize (Zea mays) pot
... (1993) The effect of cross-linking of the subunits of NADPH -protochlorophyllide oxidoreductase on the aggregational state of protochlorophyllide Photosynthetica 29, 205–218 Wiktorsson, B., Ryberg, ... The effect of the presence of the adenylates on the ability of POR-PChlide640 to undergo photoconversion was checked by comparing the efficiency of photoconversion of PLB samples containing excess ... isolate the contribution of the pH- driven conformational changes from the other effects, a parallel study was carried out on the low- pH induced blue shift in the PChlide absorption maximum of nonphotoconverted...
- 11
- 637
- 0
A SYSTEM OF LOGIC, RATIOCINATIVE AND INDUCTIVE, BEING A CONNECTED VIEW OF THE PRINCIPLES OF EVIDENCE, AND THE METHODS OF SCIENTIFIC INVESTIGATION pdf
... cut the matter short by saying, two ideas They would say, that the subject and predicate are both of them names of ideas; the idea of gold, for instance, and the idea of yellow; and that what takes ... conception, and the like? Probably all these would have been placed by the Aristotelian school in the categories of actio and passio; and the relation of such of them as are active, to their objects, and ... Whether moral and social phenomena are really exceptions to the general certainty and uniformity of the course of nature; and how far the methods by which so many of the laws of the physical...
- 1,048
- 548
- 0
THE SURFACE COATING OF CAR BODIES pptx
... interfere with the way the paint bonds to the metal surface, creating gaps in the coating that encourage corrosion For this reason, any greases deposited on the metal during the assembly of the car body ... 3) The results demonstrate the superior cratering resistance of the newer type of cathodic electrocoating X-Polymers-F -Car Bodies- 7 Table - The effect of oil contamination on cathodic electrocoatings ... X-Polymers-F -Car Bodies- 8 THE ANODIC PROCESS The following sections describe the reactions used in the anodic process These are essentially similar to those of the cathodic process, but for the reasons...
- 13
- 328
- 0
Báo cáo "The dependence of the nonlinear absorption coefficient of strong electromagnetic waves caused by electrons confined in rectangular quantum wires on the temperature of the system" doc
... expressions of the nonlinear absorption coefficient of a strong EMW by confined electrons in RQWs with infinite potential (Eq.9 and Eq.10), we see that the dependence of the nonlinear absorption coefficient ... Journal of Science, Mathematics - Physics 26 (2010) 115-120 show the dependence of the nonlinear absorption coefficient of a strong EMW by confined electrons in RQW on the temperature T of the system ... Scattering) Fig Dependence of α on T (Electron- acoustic Phonon Scattering) Figure shows the dependence of the nonlinear absorption coefficient of a strong EMW on the temperature T of the system...
- 6
- 414
- 2
Đề tài " Combinatorics of random processes and sections of convex bodies " pptx
... Annals of Mathematics, 164 (2006), 603–648 Combinatorics of random processes and sections of convex bodies By M Rudelson and R Vershynin* Abstract We find a sharp ... cardinality of the set A COMBINATORICS OF RANDOM PROCESSES 617 Separating tree This and the next step are versions of corresponding steps of [MV 03], where they were written in terms of function ... Gaussian processes A quantitative version of Theorem 1.1 is the following bound on Gaussian processes indexed by F in terms of the combinatorial dimension of F COMBINATORICS OF RANDOM PROCESSES...
- 47
- 371
- 0
Báo cáo khoa học: Dynamin-like protein-dependent formation of Woronin bodies in Saccharomyces cerevisiae upon heterologous expression of a single protein pdf
... typical hexagonal shape of a N crassa Woronin body (C) A giant rectangular Woronin body is captured from the side (D) A small Woronin body is still attached to a peroxisome (*), representing an intermediate ... (Kansas City, KS, USA) Plasmids and cloning procedures For heterologous expression in yeast, N crassa HEX1 was amplified from a N crassa cDNA library using PCR with primer pair RE951 (AAGAATTCATGGGCTACTACGA ... conducted, in the presence or absence of detergent Examination of a wild-type PNS revealed increasing amounts of peroxisomal marker proteins in the pellet fractions upon increasing centrifugation...
- 10
- 350
- 0
Báo cáo Y học: Interaction of the GTS1 gene product with glyceraldehyde3-phosphate dehydrogenase 1 required for the maintenance of the metabolic oscillations of the yeast Saccharomyces cerevisiae pdf
... previously [14 ,16 ] GTS1[ DKN] and GTS1[ C5 3Y] inserted into pAUR 112 were transformed into gts1D and the transformants were named pACGTS1 [DKN]/gts1D and pACGTS1[C5 3Y] /gts1D, respectively The yeast ... and GTS1 and TDH mutants Strain Cell density (· 10 )8ÆmL )1) a Wild-type gts1D pACGTS1[N-C]/gts1D pACGTS1[DKN]/gts1D pACGTS1[C5 3Y] /gts1D tdh1D tdh2D tdh3D pACTDH1/tdh1D pACTDH1pr.TDH2/tdh1D pACTDH1pr.TDH3/tdh1D ... when the wild-type GTS1 was overexpressed in gts1D (pYXGTS1/gts1D) (Fig 3) When gts1D cells overexpressed Gts1p-C5 3Y or Gts1p-DKN, the duration of the oscillations was lengthened Binding of Gts1p...
- 10
- 410
- 0
Báo cáo "Thermomechanical characteristics of rigid poly(vinyl chloride) crosslinked by a peroxide in the presence of trimethylolpropane trimethacrylate " pdf
... between the uncrosslinked - and crosslinked PVC samples is 16oC Among the samples crosslinked by DAPC and TMPTMA, the sample containing 0.2 phr of DAPC and 15 phr of TMPTMA has the minimum softening ... crosslinked by DAPC and TMPTMA is higher than that of the uncrosslinked samples It reflects an useful increase in service temperature of the material At any concentration of TMPTMA, a maximum glass transition ... the crosslinked PVC samples is higher than that of the uncrosslinked PVC samples This is explained by the crosslinking PVC in the presence of DAPC and TMPTMA as mentioned above At any concentration...
- 5
- 377
- 0
Từ khóa: Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ