Strategy development of mobifone products for teenage market segment period 2011-2015
Development of DMC controllers for temperature control of a room deploying the displacement ventilation HVAC system
... develop a controller for temperature control inside a room within a desired band of temperatures for comfort The details of the geometry of the room and the HVAC system based on displacement ventilation ... disadvantages of the DMC controller First, the DMC controller is a local controller which can only guarantee the stability of the system in a local area Second, the DMC controller is a model-based controller ... controlling the temperature in a room deploying a displacement ventilation HVAC system without heater It is a nonlinear system with large disturbance, which has delay in the control variable and in the...
- 12
- 556
- 0
Tài liệu The Development of the Feeling for Nature in the Middle Ages and Modern Times doc
... out of the earth 'And wine that maketh glad the heart of man The Development of the Feeling for Nature in the Middle Ages and Modern Times 'The trees of the Lord are full of sap; the cedars of ... life, of mind, mood, and feeling, The Development of the Feeling for Nature in the Middle Ages and Modern Times which we have given it.' And Ebers, 'Lay down your best of heart and mind before ... The Development of the Feeling for Nature in the Middle Ages and Modern Times chief phases of landscape, painting, and garden craft, I have aimed at giving completeness to the historical...
- 194
- 633
- 0
The importance of project management in small- and medium-sized enterprises (SMEs) for the development of new products through E-collaboration docx
... development by the project manager through ecollaboration Project management process All projects have a beginning and an ending, and project management has corresponding initiating and closing ... facilitate the progression to reduce time and cost in developing new products in SMEs To understand the importance of coordinating these sections with the project manager and validated the model, the ... According to these definitions and the importance of SMEs in manufacturing industries in this research, the author chose these types of companies Strengths and weakness characteristics of SMEs in...
- 12
- 980
- 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT ... AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢);...
- 14
- 473
- 0
Báo cáo khoa học: " The Development of Lexical Resources for Information Extraction from Text Combining Word Net and Dewey Decimal Classification" potx
... ambiguity in WordNet by combining its information with another source of information: the Dewey Decimal Classification (DDC) (Dewey, 1989) Reducing the lexical ambiguity in W o r d N e t The main ... greatly reduce the ambiguity implied by the use of WordNet by finding the correct set of field labels that cover all the WordNet hierarchy in an uniform way Therefore we can reduce the overhead ... those The presence of all the relevant terms should guarantee that the information in the text is never lost; inserting just the relevant terms allows to limit the development effort, and should...
- 4
- 436
- 0
DEVELOPMENT OF STUDENTS’ ENGLISH FOR SPECIAL PURPOSES COMPETENCE IN TOURISM STUDIES AT TERTIARY LEVEL potx
... determine students’ ESP Development of students’ English for Special Purposes competence in tourism studies at tertiary level Dr Ineta Luka, School of Business Administration Turiba, Latvia 13 competence ... stage of the research to create the model for the development of students’ ESP competence Development of students’ English for Special Purposes competence in tourism studies at tertiary level Dr Ineta ... result forming new experiences Development of students’ English for Special Purposes competence in tourism studies at tertiary level Dr Ineta Luka, School of Business Administration Turiba, Latvia...
- 32
- 470
- 0
báo cáo hóa học:" Development of targeted therapy for ovarian cancer mediated by a plasmid expressing diphtheria toxin under the control of H19 regulatory sequences" doc
... evaluate the therapeutic potential of expression vectors carrying the "A" fragment of the diphtheria toxin (DT -A) gene under the control of the H19 regulatory sequences in an ovarian carcinoma ... expression profiling allows an individualized DNA-base approach to cancer therapy The therapeutic potential of the DTA -H19 vector was tested in a rat animal tumor model for colorectal liver metastases ... effective antitumor agents Various gene therapy strategies for the treatment of ovarian cancer are currently under development and aim towards maximal treatment efficacy and minimal adverse effects...
- 11
- 559
- 0
Strategic development of 3G products - services of Mobifone period 2011 - 2015
... CHAPTER DEVELOPMENT STRATEGY OF 3G PRODUCTS - SERVICES OF MOBIFONE IN THE PERIOD OF 2011 – 2015 3.1 The development orientation of MobiFone Company in the next period 3.1.1 State orientation in development ... C02 .Strategic Management.Capstone Project Report Group CHAPTER DEVELOPMENT STRATEGY OF 3G PRODUCTS - SERVICES OF MOBIFONE IN THE PERIOD OF 2011 – 2015 49 3.1 The development orientation of ... Development Strategy of 3G Products - Services of VMS in the Period of 201 1-2 015 10 C02 .Strategic Management.Capstone Project Report Group CHAPTER I THEORETICAL BASIS OF BUSINESS STRATEGIC PLANNING...
- 88
- 833
- 9
DEVELOPMENT OF PROBIOTIC PRODUCTS FOR USAGE IN SHRIMP FARMING
... DEVELOPMENT OF PROBIOTIC PRODUCTS FOR USAGE IN SHRIMP FARMING SCHOOL OF BIOTECHNOLOGY AND FOOD TECHNOLOGY HANOI UNIVERSITY OF TECHNOLOGY DAI CO VIET, HANOI, ... farming in our country are facing many difficulties, the shrimp died in a series of large scale Research to create effective biological products, to increase disease resistance of shrimp farming ... Email: biofotech@mail.hut.edu.vn Export of frozen shrimp constitutes a large proportion of the Seafood export in Vietnam However, currently the shrimpfarming in our country is facing a lot of difficulties...
- 2
- 241
- 0
Từ khóa: design and development of food productsdesign and development of new productsdesign and development of information productsdevelopment of new products probiotics and probiotic foodsdevelopment of emission inventories for egusdevelopment of emission inventories for non egu point sourcesBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP