behaviour of chlorpropham and its main metabolite 3-chloroaniline in soil and water systems

Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge

Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge

... 40 - Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge Toshikazu Fukushima*, Naoki Uda*, Motoharu Onuki**, ... Quantification using Quantitative PCR and FISH method in Activated sludge The amount of Candidatus ‘Accumulibacter phosphatis’ in the labo...
Ngày tải lên : 05/09/2013, 09:38
  • 7
  • 719
  • 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_1:AA GATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1888 CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 1870 Fig. ... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACG...
Ngày tải lên : 07/03/2014, 16:20
  • 12
  • 772
  • 0
Báo cáo khoa học: "Categorial Fluidity in Chinese and its Implications for Part-of-speech Tagging" pptx

Báo cáo khoa học: "Categorial Fluidity in Chinese and its Implications for Part-of-speech Tagging" pptx

... the Chinese Language, pages 353-372. Zhu, D. 2001. Xiandai Hanyu Yufa Yanjiu. Beijing: Com- mercial Press. 118 Categorial Fluidity in Chinese and its Implications for Part-of-speech Tagging OiYeeKwong  Benjamin ... ambiguity and categorial fluidity in Chinese and the diffi- culty thus posed on tagging. Then in Section 3, we report on a preliminary empirical...
Ngày tải lên : 08/03/2014, 21:20
  • 4
  • 397
  • 0
Báo cáo khoa học: Structural flexibility of the methanogenic-type seryl-tRNA synthetase active site and its implication for specific substrate recognition pptx

Báo cáo khoa học: Structural flexibility of the methanogenic-type seryl-tRNA synthetase active site and its implication for specific substrate recognition pptx

... consists of a long a-helical arm, and extensions in the N- and C-termini of the enzyme ensure recognition of two unusual mitochondrial tRNAs Ser [11]. In general, the active sites of seryl-tRNA synthetases ... diminished Fig. 5. Model of the acceptor end of tRNA Ser bound in the active site of mMbSerRS. The view is focused on the acceptor part of tR...
Ngày tải lên : 16/03/2014, 06:20
  • 14
  • 357
  • 0
Báo cáo khoa học: Identification and expression analysis of an IL-18 homologue and its alternatively spliced form in rainbow trout (Oncorhynchus mykiss) doc

Báo cáo khoa học: Identification and expression analysis of an IL-18 homologue and its alternatively spliced form in rainbow trout (Oncorhynchus mykiss) doc

... 271) 1921 Identification and expression analysis of an IL-18 homologue and its alternatively spliced form in rainbow trout ( Oncorhynchus mykiss ) Jun Zou 1 , Steve Bird 1 , Jonathan Truckle 1 , ... alternative splicing may play an important role in regulating IL-18 activities in rainbow trout. Keywords: interleukin 18; alternative splicing; expres...
Ngày tải lên : 16/03/2014, 16:20
  • 11
  • 426
  • 0
Báo cáo khoa học: Levels of mTOR and its downstream targets 4E-BP1, eEF2, and eEF2 kinase in relationships with tau in Alzheimer’s disease brain doc

Báo cáo khoa học: Levels of mTOR and its downstream targets 4E-BP1, eEF2, and eEF2 kinase in relationships with tau in Alzheimer’s disease brain doc

... control in Alzheimer’s disease X. Li et al. 4214 FEBS Journal 272 (2005) 42114220 ê 2005 FEBS Levels of mTOR and its downstream targets 4E-BP1, eEF2, and eEF2 kinase in relationships with tau in Alzheimer’s disease ... correla- tion with tau nonphosphorylated at Tau1 sites. Total and phosphorylated levels of eEF2K and eEF2 in AD...
Ngày tải lên : 16/03/2014, 22:20
  • 10
  • 376
  • 0
Báo cáo khoa học: Structures and mode of membrane interaction of a short a helical lytic peptide and its diastereomer determined by NMR, FTIR, and fluorescence spectroscopy pdf

Báo cáo khoa học: Structures and mode of membrane interaction of a short a helical lytic peptide and its diastereomer determined by NMR, FTIR, and fluorescence spectroscopy pdf

... interaction of a short a helical lytic peptide and its diastereomer determined by NMR, FTIR, and fluorescence spectroscopy Ziv Oren 1, *, Jagannathan Ramesh 2, *, Dorit Avrahami 1 , N. Suryaprakash 2, †, ... suggest that the a helical structure is not a prerequisite for maintaining an interface localization of a peptide. In summary, the structu...
Ngày tải lên : 17/03/2014, 11:20
  • 12
  • 409
  • 0
Báo cáo khoa học: The complex of the insect LDL receptor homolog, lipophorin receptor, LpR, and its lipoprotein ligand does not dissociate under endosomal conditions pot

Báo cáo khoa học: The complex of the insect LDL receptor homolog, lipophorin receptor, LpR, and its lipoprotein ligand does not dissociate under endosomal conditions pot

... Journal compilation ê 2008 FEBS The complex of the insect LDL receptor homolog, lipophorin receptor, LpR, and its lipoprotein ligand does not dissociate under endosomal conditions Sigrid D. Roosendaal 1 , ... the case of the hybrid receptor LDLR(1–251)LpR(302–850) (Fig. 4F), the ligand- binding domain of which is com- posed of the si...
Ngày tải lên : 23/03/2014, 07:20
  • 16
  • 354
  • 0
Báo cáo khoa học: Huntington’s disease: roles of huntingtin-interacting protein 1 (HIP-1) and its molecular partner HIPPI in the regulation of apoptosis and transcription pptx

Báo cáo khoa học: Huntington’s disease: roles of huntingtin-interacting protein 1 (HIP-1) and its molecular partner HIPPI in the regulation of apoptosis and transcription pptx

... MINIREVIEW Huntington’s disease: roles of huntingtin-interacting protein 1 (HIP -1) and its molecular partner HIPPI in the regulation of apoptosis and transcription Nitai P. ... chain B; ENTH, Epsin N-terminal homology; HD, Huntington’s disease; HIP -1, huntingtin-interacting protein 1; HIPPI, huntingtin-interacting protein 1 interactor; Htt...
Ngày tải lên : 23/03/2014, 07:20
  • 9
  • 492
  • 0
Báo cáo khoa học: Membrane trafficking of CD98 and its ligand galectin 3 in BeWo cells ) implication for placental cell fusion pot

Báo cáo khoa học: Membrane trafficking of CD98 and its ligand galectin 3 in BeWo cells ) implication for placental cell fusion pot

... forskolin-treated BeWo cells. Inhibition of galectin 3 binding to membrane glycoproteins affects cellular fusion We then investigated whether the close proximity of CD98 and galectin 3 in several cellular ... Authors Journal compilation ª 2007 FEBS 2719 Membrane trafficking of CD98 and its ligand galectin 3 in BeWo cells ) implication f...
Ngày tải lên : 23/03/2014, 09:20
  • 13
  • 385
  • 0
Báo cáo khoa học: A novel glycogen-targeting subunit of protein phosphatase 1 that is regulated by insulin and shows differential tissue distribution in humans and rodents pdf

Báo cáo khoa học: A novel glycogen-targeting subunit of protein phosphatase 1 that is regulated by insulin and shows differential tissue distribution in humans and rodents pdf

... ATC CAC TTT ATC TGA gacgaggcgcctgcggccgacggcggaaaacaccaaaggcacccgggggcggggcgacccgatgtggcggggaggagtag 920 276 I H F I * 279 9 21 gagagaccaggattggcgggagcggtccaagggagtc 957 Fig. 1. (A) Diagram of ... be regulated acutely by insulin. Assay of PP1 following insulin infu- sion of skeletal muscle and immunopelleting of PP1-G M showed a 1. 5–2-fold increase in phosphatase a...
Ngày tải lên : 30/03/2014, 16:20
  • 12
  • 381
  • 0
Báo cáo Y học: Purification and characterization of the thyrotropin-releasing hormone (TRH)-degrading serum enzyme and its identification as a product of liver origin doc

Báo cáo Y học: Purification and characterization of the thyrotropin-releasing hormone (TRH)-degrading serum enzyme and its identification as a product of liver origin doc

... a molecular mass of 125 000 Da was estimated for the liver enzyme and the serum enzyme and a molecular mass of 116 000 Da for the brain enzyme, indicating that all these enzymes exist as homodimers, ... that the TRH-degrading enzyme (TRH-DE) is absent in the p lasma of neonatal rats, whereas TRH is rapidly inactivated by plasma of adult rats [39]. The...
Ngày tải lên : 31/03/2014, 21:21
  • 9
  • 477
  • 0
defending the society of states why america opposes the international criminal court and its vision of world society jul 2007

defending the society of states why america opposes the international criminal court and its vision of world society jul 2007

... Likewise, Heather Hamilton of the American Coalition for the International Criminal Court was helpful in the initial stages of my inquiry. The creation of the International Criminal Court is often held ... Little, International System, International Society and World Society: A Re- evaluation of the English School’, in B. A. Roberson (ed.), Internati...
Ngày tải lên : 10/06/2014, 22:16
  • 255
  • 441
  • 0
behaviour of chlorpropham and its main metabolite 3-chloroaniline in soil and water systems

behaviour of chlorpropham and its main metabolite 3-chloroaniline in soil and water systems

... 1 BEHAVIOUR OF CHLORPROPHAM AND ITS MAIN METABOLITE 3-CHLOROANILINE IN SOIL AND WATER SYSTEMS BANDAR RASHED M. ALSEHLI BSc., King Abdulaziz University, Saudi ... >0.999) and the limit of quantification was 0.001 mg/L. Preparation of CIPC, IPC and 3CA standards in water from stock solutions in methanol and directly by dissolution in wate...
Ngày tải lên : 22/12/2014, 21:19
  • 381
  • 380
  • 0

Xem thêm

Từ khóa: