... DnaJ-For5'GGAATACAGGAGGGG GACAT, Rev5'CCTTTTGGGAGAACCAAACA; BADH-For5'TGGAAAATTGCTCCAGCTCT, Rev5'CTGGACCTAATCCCGTCAAA; Actin-For5'AAACCACAAGCCCCTAAACC, Rev5'TTGCATCACTCAGCACCTTC. ... genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridizationBinod B Sahu* and Birendra P ShawAddress: Environmental Biotechnology Laboratory, Institute of ... domain in AMPK has greater affinity forAMP than for ATP, and as the cellular energy contentdrops (low ATP, high AMP), binding of AMP to CBSdomain of AMPK facilitates its phosphorylation makingthe...