0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Tiến sĩ >

synthesis and characterization of novel polymers for functional and stimuli responsive silicon surfaces

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

... using primers (5Â-CGTCAAGGAGAAAAAACCCCGGATCTAAAA AATGGAGC AGAAA CTCATCTCTGAAGAGGATCTG -3Â) and (5Â- GCATGC CTGCAGGTCGACTCTAGAGGATCTCAAGCCAGTGACCGCCTCCC-3Â), and checked for the presence and ... (5Â-AGCTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAATTTTGCTGCC-3Â); for OR17-40 (5Â-CGTCAAGGAGAAAAAACCCCGGATCTAAAAAATGGAGCAGAAACTCATCTCTGAAGAGGATCTG-3Â) and (5Â-GCATGCCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGTGACCGCCTCCC-3Â); for Golf(5Â-GGTACCGCTGCAATGGGGTGTTTGGGCAAC-3Â) ... was performed on DNAse-treated RNA extracts. Primers used for RT-PCR were: for the I7 OR (5Â-CGTCAAGGAGAAAAAACCCCGGATCTAAAAAATGGAGCGAAGGAACCACAG-3Â) and (5Â-AGCTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAATTTTGCTGCC-3Â);...
  • 14
  • 473
  • 0
Báo cáo Y học: Purification and characterization of novel kininogens from spotted wolffish and Atlantic cod pdf

Báo cáo Y học: Purification and characterization of novel kininogens from spotted wolffish and Atlantic cod pdf

... Glycobiology 2,2540.2646 A. Yloănen et al. (Eur. J. Biochem. 269) Ó FEBS 2002 Purification and characterization of novel kininogens from spotted wolffish and Atlantic cod Anne Yloă nen1, Jari Helin1, ... sequencing of the kininogens was only success-ful from the 42-kDa band of wolffish kininogen(XLVQPGVLI…, Table 1). The major bands of both kininogens and also the 60-kDa band of cod kininogen ... far.Here, we describe the purification of kininogens from theskin of spotted wolffish (Anarhichas minor)andAtlantic cod (Gadus morhua L.). These novel kininogens werecharacterized by determining their...
  • 8
  • 428
  • 0
Synthesis and characterization of semiconducting nanowires for gas sensing

Synthesis and characterization of semiconducting nanowires for gas sensing

... lateraldimension of the nanowires will allow the systematic investiga-tion of size reduction effects on the electrical and gas sensing behavior of ZnO nanowires. Fig. 3. Characteristics of In3O2 nanowires: ... 208–213 Synthesis and characterization of semiconducting nanowires for gas sensing G. Sberveglieri∗, C. Baratto, E. Comini, G. Faglia, M. Ferroni,A. Ponzoni, A. VomieroSENSOR Lab of CNR-INFM and Dipartimento ... manipulators for structural and electrical characterization, (c) ED pattern of nanowire, (d) STEM-HAADF image of a nanowire, and (e) linescan of theHAADF signal (solid line) and numerical fit of the...
  • 6
  • 662
  • 0
Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

... Sahin et al. (Eur. J. Biochem. 271) Ó FEBS 2004 Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation Bogachan Sahin1, Janice ... E-mail: james.bibb@utsouthwestern.eduAbbreviations: AK, adenosine kinase; Ado, adenosine; hAK, human adenosine kinase; mAK, mouse adenosine kinase. Note: Nucleotide sequence data for the long and ... kinase and 5Â- nucleotidase activity after pro-longed wakefulness in the cortex and the basal forebrain of rat.Neurochem . Int. 42, 4 49–454.Ó FEBS 2004 Recombinant mouse AK as a protein phosphorylation...
  • 9
  • 497
  • 0
Báo cáo khoa học: Identification and characterization of novel PKA holoenzymes in human T lymphocytes pdf

Báo cáo khoa học: Identification and characterization of novel PKA holoenzymes in human T lymphocytes pdf

... one-third of thePKI-inhibited activity was released into the extract, indi-cating that the precipitated Cb2 colocalized with Ca1onRIa and RIIa in a ratio of 2 : 1. Of the total PKA kin-ase activity, ... Cb2 activity in Cb2-transfected29 3T cells was precipitated. Taken together it is there-fore reasonable to assume that Cb2 activity may consti-tute more than 20% of total PKA activity in T- cells.It ... activity in the precipitate from Cb2 transfected cells were 15-foldhigher than the activity in the precipitate from the Ca1transfected cells demonstrating that the Cb2 antibody in combination with...
  • 9
  • 406
  • 0
Báo cáo Y học: Cloning and characterization of novel snake venom proteins that block smooth muscle contraction pptx

Báo cáo Y học: Cloning and characterization of novel snake venom proteins that block smooth muscle contraction pptx

... determinedby peptide sequencing are underlined.2710 Y. Yamazaki et al. (Eur. J. Biochem. 269) Ó FEBS 2002 Cloning and characterization of novel snake venom proteins that block smooth muscle contraction Yasuo ... property that underlies its ability to block K+-induced contractions of aortic smooth muscle and spontaneous contractions of uterine smooth muscle [37]. Furthermore, we demonstrate that several snake ... isolated several novel snake venom proteins. One of these proteins, ablomin, which waspurified from the venom of A. blomhoffi, blocks high K+-induced contraction of arterial smooth muscle. We alsocloned...
  • 8
  • 472
  • 0
facile synthesis and characterization of novel nanocomposites

facile synthesis and characterization of novel nanocomposites

... Chemistry and Physics 100 (2006) 507–512 Facile synthesis and characterization of novel nanocomposites of titanate nanotubes and rutile nanocrystalsJiaguo Yu∗, Huogen YuState Key Laboratory of Advanced ... the best of our knowledge, this is thefirst time to observe this novel morphological structure of the nanocomposites of rutile nanocrystals and titanate nanotubes.Fig. 2. XRD patterns of the starting ... water and hydroxyl groups existed in the tubularproducts because of the existence of a bending vibration of HO H at 1630 cm−1, and a strong stretching vibration of O HFig. 4. EDX spectrum of...
  • 6
  • 519
  • 1
synthesis and characterization of novel ferromagnetic ppy-based nanocomposite

synthesis and characterization of novel ferromagnetic ppy-based nanocomposite

... spectra of PPy (a) and PPy/Zn0.5Cu0.5Fe2O4 nanocomposite (b).Fig. 2. XRD patterns of PPy/Zn0.5Cu0.5Fe2O4 nanocomposite (a) and the referencestandard data for Zn0.5Cu0.5Fe2O4 of ... kOe.3. Results and discussionsThe structures of the PPy/Zn0.5Cu0.5Fe2O4 nanocomposite wereinvestigated by FTIR spectroscopy and X-ray diffraction. FTIR spectra of the PPy and PPy/Zn0.5Cu0.5Fe2O4 nanocomposite ... micrographsof Zn0.5Cu0.5Fe2O4(a) and PPy/Zn0.5Cu0.5Fe2O4 nanocomposite (b).Fig. 4. Magnetization curves of Zn0.5Cu0.5Fe2O4(a) and PPy/Zn0.5Cu0.5Fe2O4 nanocomposite (b);...
  • 3
  • 571
  • 0
Báo cáo khoa học: Purification and characterization of novel salt-active acharan sulfate lyase from Bacteroides stercoris HJ-15 ppt

Báo cáo khoa học: Purification and characterization of novel salt-active acharan sulfate lyase from Bacteroides stercoris HJ-15 ppt

... of purified salt-active acharan sulfate lyase The purified salt-active acharan sulfate lyase degradedheparin and heparan sulfate as well as acharan sulfate (Table 5). The salt-active acharan sulfate ... lyase II.Keywords: Bacteroides stercoris HJ-15; salt-active acharan sulfate lyase; acharan sulfate lyase; acharan sulfate; heparin.Heparin, heparan sulfate and acharan sulfate glycosamino-glycans ... heparan sulfate, acharan sulfate and chondroitin sulfate [13–16]. We purifiedtwo kinds of novel heparin lyases, heparin lyase II-1 (acharan sulfate lyase 1), and heparin lyase II-2 (acharan sulfate...
  • 6
  • 400
  • 0
Báo cáo khoa học: Identification and characterization of novel salivary thrombin inhibitors from the ixodidae tick, Haemaphysalis longicornis doc

Báo cáo khoa học: Identification and characterization of novel salivary thrombin inhibitors from the ixodidae tick, Haemaphysalis longicornis doc

... et al.(Eur. J. Biochem. 270) Ó FEBS 2003 Identification and characterization of novel salivary thrombin inhibitors from the ixodidae tick, Haemaphysalis longicornis Shiroh Iwanaga1, Masakazu ... inhibition of thrombin by antithrombin III[13] and heparin cofactor II [14]. Furthermore, both exositesareinvolvedintherecognitionoffactorVandfactorVIIIby thrombin [15]. The salivary glands of blood-sucking ... salivary glands of H. longicornis [24]. According to thisreport, an extract of the salivary glands prolonged bothAPTT and PT, suggesting the presence of an inhibitor of either factor Xa or thrombin. ...
  • 9
  • 337
  • 0
Báo cáo Y học: Purification and characterization of novel chondroitin ABC and AC lyases from Bacteroides stercoris HJ-15, a human intestinal anaerobic bacterium pptx

Báo cáo Y học: Purification and characterization of novel chondroitin ABC and AC lyases from Bacteroides stercoris HJ-15, a human intestinal anaerobic bacterium pptx

... Purification and characterization of novel chondroitin ABC and AC lyases from Bacteroides stercoris HJ-15, a human intestinal anaerobic bacterium Sung-Woon Hong1, Byung-Taek Kim1, Ho-Young ... previously purified chondroitin lyases. In conclusion, this is the first report on the purification and characterization of chondroitin ABC and AC lyases, particulary chondroitin AC lyase, from an anaerobic bacterium ... of each enzyme with trypsin(Table 3). The internal sequences of chondroitin ABC and AC lyase show significantly greater homology of 59 and 80% to Flavobacterial chondroitin AC lyase, and 57and...
  • 7
  • 292
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Purification and characterization of novel fibrinolytic proteases as potential antithrombotic agents from earthworm Perionyx excavatus" pot

... 1:26http://www.amb-express.com/content/1/1/26Page 9 of 11 ORIGINAL Open Access Purification and characterization of novel fibrinolytic proteases as potential antithrombotic agents from earthworm Perionyx excavatusTram ... 41(11):1068–73.doi:10.1186/2191-0855-1-26Cite this article as: Phan et al.: Purification and characterization of novel fibrinolytic proteases as potential antithrombotic agents from earthworm Perionyx excavatus. AMB Express 2011 1:26.Submit ... Follow-up results of a prospective study. Acta MedScand 211(1-2):65–8.Cho IH, Choi ES, Lim HG, Lee HH (2004) Purification and characterization of six fibrinolytic serine -proteases from earthworm Lumbricus...
  • 11
  • 375
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Editorial Novel Techniques for Analysis and Design of Cross-Layer Optimized Wireless Sensor Networks" docx

... on Wireless Communications and NetworkingVolume 2007, Article ID 31647, 3 pagesdoi:10.1155/2007/31647 Editorial Novel Techniques for Analysis and Design of Cross-Layer Optimized Wireless Sensor ... process, and represent thestate of the art on cross-layer design for WSNs. All of themtake into account the unique peculiarities, advantages, and shortcomings of wireless sensor networks, and propose ... almost all other types of wireless and wired networks, WSNs are built for a specificapplication in mind, and so al l layers must be cognizant of the features of this application and coordinate in...
  • 3
  • 280
  • 0
synthesis and characterization of novel polymers for functional and stimuli responsive silicon surfaces

synthesis and characterization of novel polymers for functional and stimuli responsive silicon surfaces

... Information and Learning Company. Synthesis and Characterization of Novel Polymers for Functional and Stimuli Responsive Silicon Surfaces Kalpana Viswanathan ABSTRACT The use of polymers ... SYNTHESIS AND CHARACTERIZATION OF NOVEL POLYMERS FOR FUNCTIONAL AND STIMULI RESPONSIVE SILICON SURFACES Kalpana Viswanathan Dissertation submitted to the Faculty of the Virginia ... composition and areal density of functional groups. The synthesis of a variety of novel functionalized polymers using living polymerization techniques to achieve functional and stimuli responsive...
  • 290
  • 393
  • 0
design, synthesis, and characterization of polymeric materials for uses in energy storage applications

design, synthesis, and characterization of polymeric materials for uses in energy storage applications

... Graduate School Department of Chemistry DESIGN, SYNTHESIS, AND CHARACTERIZATION OF POLYMERIC MATERIALS FOR USES IN ENERGY STORAGE APPLICATIONS A Thesis in Chemistry by Daniel ... numbers of other synthetic polymers were developed and commercialized in response to the growing need for new materials in the automotive and aerospace industries. Some of these new materials include ... design, synthesis, and characterization of polymeric materials for energy storage applications, which include small molecule electrolyte additives, solid polymer electrolyte, and gel polymer electrolyte...
  • 229
  • 608
  • 0

Xem thêm

Từ khóa: identification detection and molecular characterization of novel monopartite begomovirusescharacterization of dendritic polymerscharacterization of condensation polymers by pyrolysis gc in the presence of organic alkaliprediction of novel targets for the cdc37 hsp90 complexand there is an immediate need for the development of novel and more effective therapeutic modalities against this deadly diseasedesign and development of polymers for gene deliveryBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP