development of on-the-go soil sensing technology for mapping soil ph, potassium and nitrate contents
Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge
... 40 - Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge Toshikazu Fukushima*, Naoki Uda*, Motoharu Onuki**, ... Quantification using Quantitative PCR and FISH method in Activated sludge The amount of Candidatus ‘Accumulibacter phosphatis’ in the laboratory-scale and the full-scale activated sludge were quantified ... quantification of Candidatus ‘Accumulibacter phosphatis’ in activated sludge. Keywords: Quantitative PCR; SYBR GREEN I; Candidatus ‘Accumulibacter phosphatis’; Activated Sludge INTRODUCTION Candidatus...
- 7
- 719
- 0
Tài liệu DEVELOPMENT OF AN AUTOUMATIC DATA PROCESSING FOR TRIAXIAL COMPRESSION TEST pdf
... diagram Fig 8. Software interface TẠP CHÍ PHÁT TRIỂN KH&CN, TẬP 11, SỐ 03 - 2008 Trang 49 DEVELOPMENT OF AN AUTOUMATIC DATA PROCESSING FOR TRIAXIAL COMPRESSION TEST Pham Hong ... Menzies, B.K., A Computer Controlled Hydraulic Triaxial Testing System, Advanced Triaxial Testing of Soil and Rock, American Society for Testing Materials - Special Technical Publication, ... [6]. Miwa Koichi, Nanba Naohiko, Miyazaki Itsuo and Tsuneyoshi Akihiko, On the Real Time Processing System for Triaxial Compression Test of Soil, Bulletin of the Faculty of Agriculture, Kagoshima...
- 9
- 613
- 0
study of wo3-based sensing materials for nh3 and no detection
... 1999AbstractGas sensing materials of WO loaded with 1 wt.% metal oxides were prepared and applied for NH and NO detection. The3 3measurement of NH and NO sensing properties of the materials revealed ... and Actuators B 66 2000 74–76www.elsevier.nlrlocatersensorb Study of WO -based sensing materials for NH and NO detection 33Xusheng Wanga,), Norio Miurab, Noboru YamazoebaDepartment of ... rR and Ss R rR , respectively, for ag gaNH and NO, where R and R were resistances of 3ag sensing element in air and in sample gas.3. Results and discussionFig. 1 shows the sensitivity of WO...
- 3
- 425
- 0
Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx
... Lucia,Australia A novel photoactivatable analog of antisauvagine-30 (aSvg-30), a specific antagonist for corticotropin-releasing factor (CRF) receptor, type 2 (CRF 2 ), has been synthesized andcharacterized. ... indicated on the right andleft.Ó FEBS 20 02 Photoactivatable CRF 2 receptor antagonist (Eur. J. Biochem. 26 9) 529 3 Development of a selective photoactivatable antagonist for corticotropin-releasing ... (Table 2) .Photoaffinity labeling experimentsAs it was found that BSA binds to CRF analogs unspeci-fically [24 ,25 ], radioactively labeled photoactivatable com-pound 1 was stored free of any carrier...
- 7
- 344
- 0
Báo cáo sinh học: " Development of an improved microneutralization assay for respiratory syncytial virus by automated plaque counting using imaging analysis" pdf
... contributionsDesign and conception of the study and co-drafted themanuscript (DPY); development of the methods and co-drafted the manuscript (EZ); assisted in the development of the automated plaque counting ... agreement andequivalence between traditional manual and automated plaque counting methods for detection of RSV neutraliz-ing antibody titers. The 180 tests performed in the pres-ence and absence of ... presence and absence of complementand sorted the data by assay, method, and complementtreatment. The range and mean of the replicate tests aredepicted in Fig. 3. The difference in the mean of 136...
- 5
- 420
- 0
báo cáo hóa học:" Development of an improved microneutralization assay for respiratory syncytial virus by automated plaque counting using imaging analysis" pptx
... CentralPage 1 of 5(page number not for citation purposes)Virology JournalOpen AccessMethodology Development of an improved microneutralization assay for respiratory syncytial virus by automated plaque ... agreement andequivalence between traditional manual and automated plaque counting methods for detection of RSV neutraliz-ing antibody titers. The 180 tests performed in the pres-ence and absence of ... presence and absence of complementand sorted the data by assay, method, and complementtreatment. The range and mean of the replicate tests aredepicted in Fig. 3. The difference in the mean of 136...
- 5
- 322
- 0
Báo cáo sinh học: "Genomics technology for assessing soil pollutio" pps
... of contact between pollutants and soil. Appropriaterisk assessment of contaminants is therefore geared towards assessing the biological effects of a polluted soil, rather thanthe total concentration ... havealready gained international acceptance through, for example, Organization for Economic Co-operation andDevelopment (OECD) or International Organization for Standardization (ISO) guidelines. Then, ... pollutants can attach. Contaminated soilscan pose a problem for society if agricultural functions,human health or ecological systems are adversely affected. Soil is also a place of intense biological...
- 5
- 224
- 0
Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc
... (principal component analysis and isomap method)Brain plan evaluation for (a) ANFIS and (b) human planFigure 7Brain plan evaluation for (a) ANFIS and (b) human plan. The DVHs are shown in (c). ANFIS ... TPS at the level of deliverable plansProstate plan evaluation for (a) ANFIS and (b) human planFigure 6Prostate plan evaluation for (a) ANFIS and (b) human plan. The DVHs are shown in (c). ANFIS ... typically smaller for ANFIS-generatedplans (by an average of 7.4%). Comparing ANFIS andoFIS for the same cases, PTV coverage was somewhat infe-rior for ANFIS generated plans, although this was a minordifference...
- 16
- 510
- 0
Development of a liposomal nanodelivery system for nevirapine ppsx
... cited.Research Development of a liposomal nanodelivery system for nevirapine Lakshmi N Ramana1, Swaminathan Sethuraman1, Udaykumar Ranga2 and Uma M Krishnan*1AbstractBackground: The treatment ... 10.1186/1423-0127-17-57Cite this article as: Ramana et al., Development of a liposomal nanodelivery system for nevirapine Journal of Biomedical Science 2010, 17:57 Ramana et al. Journal of Biomedical Science 2010, ... Driscoll CMO: A comparison of intestinal lymphatic transport and systemic bioavailability of saquinavir from three lipid based formulation in the anaesthetized rat model. J Pharm Pharmacol 2006,...
- 9
- 359
- 0
Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx
... (CCTCAGAACGTTGATGGCA)and P2r (ATTGCTTTCCTTTTTCACAA GA) and allele-specific primer s Pnf (AGCATTTGGTTTTAAATTATG-GAGTATATG) and Pmr (GTTTTACTTACTCTCGTCTCCACAAAA). The PCR was run for 35 cycles ... K, Kameda T, Takenaka K, Oku S,Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K,Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primarymyelofibrosis and ... with JAK2V617F, it may take many years to show a clear MPN symptom, and some may never reach the stagebefore they die of other diseases. It is also likely thatJAK2V617F-bearing cells may stay dormant...
- 7
- 435
- 0
Báo cáo y học: "Development of a synoptic MRI report for primary rectal cancer" ppsx
... develop a synoptic MRI report for primary rectal cancer, and to elicit theopinions of radiologists regarding enablers and barrierstowards the implementation and sustainability of synop-tic reports ... presentand describe key elements or templates for MRI reporting of rectal cancer. Data on type of article, citation, and keycriteria will be extracted and tabulated to generate an evi-dence table. ... data collectionand analysis. All authors read and approved the finalmanuscript.Additional materialAcknowledgementsThis study has been funded by Cancer Services Innovation Partnership, a...
- 6
- 440
- 0
báo cáo khoa học: " Development of a synoptic MRI report for primary rectal cancer" doc
... information in a tabular,rather than descriptive form. Templates are created specif-ically for a particular setting and can be filled in by thereporting physician. Synoptic reports are of ... is an extremely important area of research, becauseoptimal patient care and clinical outcomes (i.e., risk of local recurrence) require accurate interpretation and doc- umentation of the MRI; as ... presentand describe key elements or templates for MRI reporting of rectal cancer. Data on type of article, citation, and keycriteria will be extracted and tabulated to generate an evi-dence table....
- 6
- 351
- 0
báo cáo khoa học:" Study on the clinical application of pulsed DC magnetic technology for tracking of intraoperative head motion during frameless stereotaxy" pdf
... pinfixation of the head is no longer required. For all otherprocedures, continuous tracking of head motion ensuresautomatic correction of spatial distortion with mechani-cal alteration of the head ... CentralPage 1 of 16(page number not for citation purposes) Head & Face MedicineOpen AccessResearch Study on the clinical application of pulsed DC magnetic technology for tracking of intraoperative ... 7Type B1 fixation of the head. (A) Patient positioned on the right side for resection of a left frontal metastasis. (B) After repo-sitioning in the prone position for resection of a left parieto-occipital...
- 16
- 422
- 0
development of on-the-go soil sensing technology for mapping soil ph, potassium and nitrate contents
... ProQuest Information and Learning Company. ii DEVELOPMENT OF ON-THE-GO SOIL SENSORS FOR MAPPING SOIL pH, POTASSIUM AND NITRATE CONTENTS Balaji Sethuramasamyraja, Ph. D. University of Nebraska, ... DEVELOPMENT OF ON-THE-GO SOIL SENSING TECHNOLOGY FOR MAPPING SOIL pH, POTASSIUM AND NITRATE CONTENTS by Balaji Sethuramasamyraja ... MEASUREMENTS AND SOLUBLE POTASSIUM AND B) CR NITRATE AND NITRATE- NITROGEN MEASUREMENTS OBTAINED THREE YEARS APART 62 FIGURE 4. 2. PRECISION (REPEATABILITY) ASSESSMENT FOR A) PH, B) POTASSIUM, AND C) NITRATE...
- 137
- 308
- 0
Từ khóa: and there is an immediate need for the development of novel and more effective therapeutic modalities against this deadly diseasedevelopment of a regional risk management framework for apec economies for use in the control and prevention of introduced marine pestsarchitecture for the development of contextsensitive mobile applicationsthe development of the internal combustion engine was responsible fordesign and development of polymers for gene deliverythe evolution of screw design technology for the injection molding processMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam