249 Like It or Not, a Discourse Marker Making Its Mark on a Wider Stage doc
249. Like It or Not, a Discourse Marker Making Its Mark on a Wider Stage doc
... like like."AL ROKER: "Do you like like? So what's the word like in German?" Like It or Not, a Discourse Marker Making Its Mark on a Wider Stage 09 May 2006AA: I'm Avi ... word like has gone from California slang to worldwide phenomenon."CARMEN FOUGHT: " ;Like is what we call a discourse marker, which means, like 'um' or 'uh,' it takes ... I'm Avi Arditti with Rosanne Skirble and this week on Wordmaster: a report from NBC News that caught our attention.RS: It& apos;s about a word that is spreading like no other.(MUSIC)FEMALE: " ;Like, ...
- 4
- 286
- 0
Báo cáo toán học: "VEGF T-1498C polymorphism, a predictive marker of differentiation of colorectal adenocarcinomas in Japanese" docx
... FAM-CCAACgCCCTCAAC C-7T Forward primer CCGAGCCGGAGAGGGA Reverse primer GCACCCAAGACAGCAGAAAGT C-7-allele probe VIC-CATGGTTTCgGAGGCC T-7-allele probe FAM-ATGGTTTCaGAGGCC Effect of NaB ... Kuwahara 1, Koichi Iwaki 1, Takao Tamura 4, Nobuo Aoyama 5, Svetlana Markova 2, Masato Kasuga 4, Katsuhiko Okumura 1, 2, 3, Toshiyuki Sakaeda 2, 6 1. Department of Hospital Pharmacy, ... Sakaeda T, Nakamura T, Okumura K. Pharmacogenetics of MDR1 and its impact on the pharmacokinetics and pharmaco-dynamics of drugs. Pharmacogenomics. 2003; 4: 397–410. 37. Sakaeda T, Nakamura...
- 7
- 243
- 0
The 1998 bleaching event and its aftermath on a coral reef in Belize doc
... representation and as propor-tional covers for statistical analysis. Repeated-measures analysis ofvariance (ANOVA) was used to compare the proportional coversof individual substrate components among ... Cay did not perform appreciablybetter in comparison with daily means of in situ data than did Day or combined Day+Night SST data. Additional information on theperformance of the Pathfinder data ... com-plete-block ANOVAs for thecoverofhard corals,macroalgae,sponges, and CTB. Proportionaldata were arcsine-transformedprior to computation of theANOVAs. Significance tests forblock (station) effects assumeno...
- 13
- 583
- 0
Báo cáo khoa học: "A Hierarchical Bayesian Language Model based on Pitman-Yor Processes" docx
... ofnatural languages. Bayesian probabilistic mod-els also have additional advantages it is rela-tively straightforward to improve these models byincorporating additional knowledge sources andto ... methodsappear as differences among rare words, with thecontribution of more common words being neg-ligible. HPYLM performs worse than MKN on words that occurred only once (on average) andbetter on ... table (assign the word to the cor-responding draw from G0), or sits at a new table(assign the word to a new draw from G0).3 Hierarchical Pitman-Yor LanguageModelsWe describe an n-gram...
- 8
- 386
- 0
Báo cáo khoa học: "A FLEXIBLE NATURAL LANGUAGE PARSER BASED ON A TWO-LEVEL REPRESENTATION OF SYNTAX" ppt
... plausible way. - The semantic knowledge plays a fundamental role in choosing a particular analysis. Milne argues that a one-word lookahead, with the substantial help of semantic information ... Issue on Natural Lan guage Processing, SlGART Newsletter 79 (1982). Konolige K.G.: A Framework for a Portable Natural Language Interface to Databases. In D.Sagalowicz (ed.): Mechanical Intelligence: ... categories. In this case all conditions a~ sociated with the different categories are evalu ated an~ in some cases more than one of them is matched. In all these cases the status of the ana...
- 8
- 412
- 0
Báo cáo khoa học: "A Statistical Machine Translation Model Based on a Synthetic Synchronous Grammar" docx
... 2.2.2 The SSG-based Translation ModelThe translation in our SSG-based translationmodel can be treated as a SSG derivation. A derivation consists of a sequence of grammar ruleapplications. To model ... derivations as a latentvariable, we define the conditional probability dis-tribution over the target translation e and the cor-Input: A source parse tree T (fJ1)Output: A target translation ... 2009 Conference Short Papers, pages 125–128,Suntec, Singapore, 4 August 2009.c2009 ACL and AFNLP A Statistical Machine Translation Model Based on a SyntheticSynchronous GrammarHongfei Jiang,...
- 4
- 339
- 1
Báo cáo hóa học: "Fabrication of a Highly Sensitive Chemical Sensor Based on ZnO Nanorod Arrays" doc
... sensitive chemical sensor based on a ZnO nanorodarray that is epitaxially grown on a Pt-coated Si substrate,with a top–top electrode configuration. To practically testthe device, its O2and NO2sensing ... meaning that the interfacialZnO layer is of an epitaxial quality and that the individualZnO nanorods are actually defect-free single crystals.To practically test the NRA chemical sensor with ... chemicalsensors based on ZnO NRAs.ZnO NRAs were synthesized on Pt-coated Si (001)substrates using a horizontal-type metal organic chemicalvapor deposition (MOCVD) system without using anymetal catalyst....
- 7
- 319
- 0
Báo cáo hóa học: " Research Article A Low-Complexity UEP Methodology Demonstrated on a Turbo-Encoded Wavelet Image " pot
... 10−5and reaches a plateau at 100%foraBERof10−3before reaching a peak at 200% for a BERof3× 10−2. Clearly additivity is not respected withinFlexWave-II and exhibits a large additivity deviation. ... the bitstream un-touched. We can see that the distortion resulting from a biterror at any location in the bitstream is always smaller thanthe distortion resulting from a truncation at the same ... distortion of allpossible protection allocations prior to the transmission, andpicked the best allocation based on the lowest distortionvalue. The full-search algorithm is not realizable with...
- 11
- 273
- 0
Báo cáo hóa học: " Research Article A Low-Complexity UEP Methodology Demonstrated on a Turbo-Encoded Wavelet Image Satellite Downlink" pptx
... 10−5and reaches a plateau at 100%foraBERof10−3before reaching a peak at 200% for a BERof3× 10−2. Clearly additivity is not respected withinFlexWave-II and exhibits a large additivity deviation. ... the bitstream un-touched. We can see that the distortion resulting from a biterror at any location in the bitstream is always smaller thanthe distortion resulting from a truncation at the same ... for any rateconstraint. This means that our low-complexity algorithmis very dynamic and can adapt to any rate condition with a simple search, without loss of optimality in the specific caseof...
- 11
- 243
- 0
Báo cáo hóa học: " Research Article Array Iterators in Lustre: From a Language Extension to Its Exploitation in Validation Lionel Morel" doc
... hardware. Moreover,this approach allows for a straightforward use of standardvalidation tools associated to the “Lustre without arrays.”2.1.3. Towards array iterators: some motivationsFor ... give a contractto that node. An assume-guarantee contract [25]isaformoflocal specification. It is made of an assertion Boolean clause,that specifies what the component expects from its environ-ment, ... used, with the condition thatfor every call to that node, this parameter be instantiated by a static constant. Finally, thewith operator allows for a staticrecursion m echanism in the language....
- 16
- 296
- 0
Từ khóa: students complete the text or notto score or not to scorea discourse copying algorithmhad god designed the world it would not bewhat not to say on a first datewhat not to say to a woman on a first dateBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíBT Tieng anh 6 UNIT 2chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP