Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc

... for Q RT-PCRPrimer Alias Sequence1082 ACT1F GCCTTCTACGTTTCCATCCA1083 ACT1R GGCCAAATCGATTCTCAAAA1367 PAC2F AATAACGAATTGAGCTATGACACCAA1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT1172 BUD6F CAGACCGAACTCGGTGATTT1173 ... validate the microarray data, we used quantitativeRT-PCR to examine the expression of five of the up-regulatedgenes in a set of RNA samples that had been used in the array analysis (Figure 3a) . ... GOstats analysis of genes altered in CDC13+ strains. Table D shows GOstats analysis of genes altered in cdc13-1 strains that are not cell cycle regulated. Tables E-Q show GOstats analysis of genes...

Báo cáo y học: "Metabolic network driven analysis of genome-wide transcription data from Aspergillus nidulan" docx

... (mitochondrial) Aspartate transaminase (mitochondrial) B-ketoacyl-ACP synthaseAspartate transaminase (mitochondrial) Aspartate transaminase (mitochondrial) Carbamoyl-phophate synthetaseATP:citrate oxaloacetate-lyase ... Maeda H, Sano M, Maruyama Y, Tanno T, Akao T, Totsuka Y, EndoM, Sakurada R, Yamagata Y, Machida M, et al.: Transcriptional anal-ysis of genes for energy catabolism and hydrolytic enzymes in ... 1,3-β-Glucan synthase 5'-Phosphoribosylformyl glycinamidine synthetaseAcetyl-CoA hydrolase Acetyl-CoA hydrolase 8-Amino-7-oxononanoate synthaseAconitate hydratase (mitochondrial) Acetyl-CoA synthase...

Báo cáo y học: " Diagnosis and phylogenetic analysis of Orf virus from goats in China: a case report" pot

... State Key Laboratory of Veterinary Etiological Biology, National Foot-and-Mouth Disease Reference Laboratory, Key Laboratory of Animal Virology of Ministry of Agriculture, Xujiaping No.1, Yanchangpu, ... incidence was approaching 60% and the mortality rate was 24.7% (162/655), although anti-viral and antibiotic medicines were administered in the drinking water, by intramuscular injection or orally.Two ... Authors wish to thank the journal editors and anonymous reviewers for their editing and revision the manuscript.Author DetailsLanzhou Veterinary Research Institute of Chinese Academy of Agriculture...

Báo cáo y học: "Mortality associated with administration of highdose tranexamic acid and aprotinin in primary open-heart procedures: a retrospective analysis" ppt

... treatment and hospitalstay was detectable (Table 2). Analysis of biochemical safety data is shown in Table 3. In this subgroup, an increase of creatinine in patients receiving TXA imme diately after ... discontinued the u se of aprotinin. From thattime, we prospectively collected anonymized data in a database evaluating parameters of efficiency and safety.Data of 336 patients receiving TXA were ... operatingprocedures. The diagnosis of myocardial infarction was based onthepresenceofnewQwavesin two contiguous elec-trocardiogram leads and an increase of myocardialcreatine kinase (CK-MB) above 10% of total...

Báo cáo y học: "Psychogenic or neurogenic origin of agrammatism and foreign accent syndrome in a bipolar patient: a case report" pdf

... agrammatism, initially categorized as being of psychogenic origin. The patient had an extensive neuropsychological and language evaluation aswell as brain imaging exams. In addition to FAS and ... (2 cases) or epi-sodes of psychosis (1 case). In 34% of these cases, FAS wasalso associated with agrammatism. Agrammatism is a fre-quent symptom of Broca's aphasia characterized by a def-icit ... developed the language disorder, he was on stable doses of lithium,valproate, quetiapine and perphenazine.Although they appeared approximately 3 years earlier, the functional origin of the FAS and agrammatism...

Báo cáo y học: "Enumeration and phenotypical analysis of distinct dendritic cell subsets in psoriatic arthritis and rheumatoid arthritis" pps

... DC enumeration, purification, cell culture, flowcytometry, ELISA and statistical analysis. ARF participated in the flow cytometry, and ARF and JAG carried out the Luminex analysis. RDS and IBM ... multiple proinflammatorycytokines and enzymes implicated in the pathogenesis of both of these disorders. Targeting cytokines has proven therapeuti-cally useful, exemplified particularly in tumour ... expression. Maturation is incomplete in the inflamed synovial compartment. Immature DCs in SF maycontribute to the perpetuation of inflammation via sampling of the inflamed synovial environment, and in...

Báo cáo y học: " Genetic and functional analysis of HIV-1 Rev Responsive Element (RRE) sequences from North-India" pdf

... 160CONSENSUS_C GACGGTACAG GCCAGACAAT TGTTGTCTGG TATAGTGCAA CAGCAAAGCA ATTTGCTGAG GGCTATAGAG GCGCAACAGCRRE-S1 .A A G G .A .C T RRE-S2 .A A G G .A .C T RRE-S3 .A A G G .A T RRE-S4 .A A G G .A T RRE-S5 .A A ... 240CONSENSUS_C ATATGTTGCA ACTCACGGTC TGGGGCATTA AGCAGCTCCA GACAAGAGTC CTGGCTATAG AAAGATACCT AAAGGATCAARRE-S1 C A C. .A .G A G.G. RRE-S2 C A C. .A .G A G.G. RRE-S3 C A C. .A .G A G.G. RRE-S4 C A C. .A ... related paper [10].They were monitored at Post Graduate Institute of Medi-cal Education and Research (PGIMER), Chandigarh by Dr A Wanchu (Clinician and one of the authors) after obtain-ing all...

Báo cáo y học: "Municipal policies and plans of action aiming to promote physical activity and healthy eating habits among schoolchildren in Stockholm, Sweden: a cross-sectional study" potx

... (are there any policies aiming to pro-mote physical activity and/or healthy eating habits, andare there any plans of action aiming to promote physicalactivity and/or healthy eating habits?), ... ReferencesPolitical environment Are there any policies aiming to promote physical activity and/or healthy eating? [25-27]Are there any plans of action aiming to promote physical activity and/or healthy eating?Are ... adopted AND be of present interest AND contain clear and measurable aims.61Are there any plans of action aiming to promote physical activity and/or healthy eating?Significant measures taken = Yes,...

Báo cáo y học: "Single ventricle with persistent truncus arteriosus as two rare entities in an adult patient: a case report" doc

... Type A3 : a single pulmonary artery originating from the arterial trunk, along with collaterals originating from the descending aorta.4. Type A4 : significant abnormalities of the aortic arch in association ... tachycardia, cyanosis, and progressive heartfailure. Later, secondary erythrocytosis and clubbing areusually present. The diagnosis may be defined by echocardiography, car-diac catheterization, ... changes.Chest radiograph indicated a small pleural effusion on the right and increased pulmonary vascularity. The heart wasmoderately enlarged with prominence of the aorta. Anechocardiogram was performed...

Báo cáo y học: " Sequence and phylogenetic analysis of H7N3 avian influenza viruses isolated from poultry in Pakistan 1995-2004" pot

... City, CA). GenBankaccession numbers are given in Table 1.Phylogenetic and Sequence Analysis Phylogenetic analysis included any available sequencedata from H7N3 isolates from Pakistan (therefore ... RG: Survey of the hemagglutinin (HA) cleavage site sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential. Avian Dis ... with increased mortality and decreased egg production. Avian Pathol 2003, 32:285-289.7. Mase M, Imada T, Sanada Y, Etoh M, Sanada N, Tsukamoto K, Kawaoka Y, Yamaguchi S: Imported parakeets harbor...

Xem thêm

Từ khóa: Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thơ nôm tứ tuyệt trào phúng hồ xuân hương Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui ro Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ