Báo cáo sinh học: "Anti-tumor effects of a human VEGFR-2-based DNA vaccine in mouse models" pps
báo cáo sinh học:" The effects of performance appraisal in the Norwegian municipal health services: a case study" pdf
... Kirkpatrick DL: Training and Performance Appraisal - Are they Related?Improving Employee Performance Through Appraisal and Coaching 2006.65. Kuvaas B: Performance Appraisal Satisfaction and ... 1 An exploration of the effects of performance appraisal in municipal health services. How goal setting, feedback and activeparticipation in performance appraisal together with the training and ... job-related goal setting, manager feedback, theemployee’s own participation in the PA and the abili ty toparticipate independently in a PA, as well as their own PAtraining and education. Thereafter,...
- 12
- 572
- 0
Báo cáo sinh học: " The effects of DNA formulation and administration route on cancer therapeutic efficacy with xenogenic EGFR DNA vaccine in a lung cancer animal model" pps
... combination forms were studied, including (1) intramuscular administration of non-coating DNA vaccine, (2) gene gun administration of DNA vaccine coated on gold particles, and (3)gene gun administration ... survival was tested by Kaplan-Meieranalysis. DNA vaccination by needle intramuscular injectionFor intramuscular needle-mediated DNA vaccination, 100μg /mouse of Sec-N'-EGFR DNA vaccines ... suggestthat increase of Th1-like CTL immune response by admin-istration of non-coating EGFR DNA vaccine may be themost potential application of EGFR DNA vaccine in thefurther clinical trials.It was...
- 13
- 305
- 0
Báo cáo sinh học: "Anti-tumor effects of a human VEGFR-2-based DNA vaccine in mouse models" pps
... therapy, and plasmid DNA vaccines[7]. Plasmid DNA vaccines are attractive because they are relatively easy toengineer and produce, and are safe to administer tohumans [8-10]. A number of studies ... delivered by an attenuated strain of Salmonella typhimu-rium[29]. Plasmid DNA vaccines are attractive becausethey are relatively easy to engineer and produce, and aresafe to administer to humans [8-10].Our ... was quantifiedby measuring the uptake of FITC-dextran into the beads.Vascularization of alginate beads was apparently reduced,and FITC-dextran uptake was significantly decreased in human VEGFR2...
- 10
- 338
- 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIWT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIY74W* WT* W11F ⁄ W168F ⁄ Y74W TCACCGGTCCATGATCCATT ... Ravindra G & Balaram P (2005) Plasmodiumfalciparum triosephosphate isomerase: new insights intoan old enzyme. Pure Appl Chem 77, 281–289.20 Parthasarathy S, Ravindra G, Balaram H, Balaram ... mutationsMousumi Banerjee1, Hemalatha Balaram2and Padmanabhan Balaram11 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India2 Molecular Biology and Genetics Unit, Jawaharlal...
- 15
- 635
- 0
Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot
... NRG-5¢_forNRG -a_ revTCTCCGGCGAGATGTCCGAGCTCCAGTGAATCCAGGTTG668b NRG-5¢_forNRG-Beta_revTCTCCGGCGAGATGTCCGAGGCAGCGATCACCAGTAAAC677GAPDH GAPDH_forGAPDH_revGAAGGGCTCATGACCACAGTCCATTCATTGTCGTACCAGGAAATGAGCTT450Fig. ... protein expression in U373 cells and mouse brain was analyzedusing the antibody against the C-terminus or against the extracellular domain. Cell lysate or the membrane fraction from mouse brainwas ... II)NRG-IG_forNRG-TM_revGCCAGGGAAGTCAGAACTTCGTTTTGCAGTAGGCCACCAC543Glycosylation sites (type I) NRG-Glyc_forNRG-TM_revCCACAGAAGGAGCAAATACTTCGTTTTGCAGTAGGCCACCAC339Kringle (type II) NRG-Kringle_forNRG-Kringle_revAGGAGGAGGAGTGGTGCTGGTCCCCAGCAGCAGCAGTA239Cysteine...
- 13
- 487
- 0
báo cáo sinh học:" Profiling alumni of a Brazilian public dental school" ppt
... technical advances, changes in the public and private health systems, an increasingnumber of professionals, increasing female enrollment in health professions, and changes in educational guidelinesare ... an exploratory data analysis technique to revealnatural grouping from latent patterns in a large data seton the basis of a minimal within-group and a maximalbetween-group variation, without ... predominantly female (64.9%), working in Goiania, the capital of the State of Goias (76.7%), andhad an undergraduate degree as their highest profes-sional training level (58.4%). Their age ranged...
- 9
- 305
- 0
Báo cáo sinh học: " Therapeutic effects of pyrrolidine dithiocarbamate on acute lung injury in rabbits" ppt
... and advising data analysis aswell as writing manuscriptJH: making study plan and advising data analysis aswell as writing manuscriptAll authors read and approved the final manuscriptAcknowledgementsThe ... in paraffin wax, stained with hematoxylin and eosin, andexamined under a light microscope. The lung injury wasscored according to inflammatory changes, hemorrhage of alveoli and interstitial ... measure-ments of TNF -a and ICAM-1 assay and isolation of PMNs. The same volume of fluid was replaced in allanimals after sampling. The superior lobe and inferiorpart of the right lung was harvested...
- 9
- 799
- 0
báo cáo hóa học: " The effects of a graduated aerobic exercise programme on cardiovascular disease risk factors in the NHS workplace: a randomised controlled trial" pdf
... still result in a mean value indicating average risk of CVD (2.2 mg/L) [33]. The mechanism behind suchaction remains unclear. It has been postulated that a reduction in CRP is attained via the positive ... that theaim of the training programme was not to directly targetweight loss for a reduction of cardiovascular risk, butinstead to improve physiological capacity, and biomark-ers of cardiovascular ... increased by 1 % each minute.Heart rate data were recorded at 1-minute intervals. Onthe initial test this was used with VO2 data to determinethe heart rate training intensity (65 % VO2 peak)...
- 10
- 662
- 0
Báo cáo sinh học: "The effects of lipids on channel function" pdf
... lipid headgroup and the two fatty acyl chains occupy roughly equal areas in the plane of the lipid bilayer, has a cylindrical shape, and so packs well into a bilayer (Figure 1b). However, a lipid ... lipid such as PA or phos-pha tidylethanolamine (PE), for which the area of the headgroup is small relative to that of the two chains, has a conical shape and will prefer to pack into a curved ... Structure and dynamics of K+ channel pore-lining helices: a comparative simulation study. Biophys J 2000, 78:79-92.9. Maeda S, Nakagawa S, Suga M, Yamashita E, Oshima A, Fujiyoshi Y, Tsukihara T:...
- 3
- 338
- 0
Báo cáo khoa hoc:" Attenuating effects of preferential treatment with Student-t mixed linear models: a simulation study" docx
... the values of Qh and A as shown in the Appendix. The averageamount of preferential treatment actually applied was assessed via a simula-tion of 1000 replicates of the ... the appropriate assumptions of preferential treatment. A Bayesian analysis of the data set according to each of the three models wascarried out in each replicate. Mean ... variance of breeding values and wj2is an ’uncertainty’ variance. The ratio O’! 2 describes the uncertainty the herd!umanager has about the true breeding value of animal...
- 19
- 302
- 0
Từ khóa: báo cáo sinh học phân tửbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThơ nôm tứ tuyệt trào phúng hồ xuân hươngKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP