Báo cáo y học: "Parallel evolution of conserved non-coding elements that target a common set of developmental regulatory genes from worms to humans" doc
... genes from three animal
phyla is very unlikely to have arisen by chance, and suggests
that a core set of developmental regulatory genes may be
associated with CNEs across all animal lineages.
Because ... this
evolution of regulatory elements may underlie the astounding
diversification of animal body plans that was seen during the
Cambrian period approximately 5...
... correspondence: Aer Lingus,
Aeroflot, Air Berlin, Air Malta, Air France, Air Scotland, Alitalia, Austrian,
bmi, British Airways, Brussels, Bulgaria Air, Condor, Croatia Airlines,
Cyprus Airways, Czech Airlines, ... data analysis and inter-
pretation of the data as well as the writing of the manuscript.
FGB participated in the data analysis and interpretation of the
study. DS particip...
... technology/mechanisms Technology to support collaboration is available and placed rapidly
in the hands of employees (KMAT)[103]
Promoting external contacts We have a system that allows us to learn ... expressed in a way that could
be inferred as an organisational characteristic (e.g., 'Our
employees resist changing to new ways of doing things'
[94]), and were excl...
... Stimulatory and inhibitory sig-
nals normally confine myofibroblasts to the period of
pulmonary alveolarization and myofibroblasts are rarely
observed in the adult lung [18]. Understanding more
about ... tissues obtained from P4 and P12
animals that were stained concurrently. To avoid variabil-
ity related to distances from the laser beam, alveolar entry
rings located 1/4 to 1...
... al[18]
should have adjusted their analysis to assume that incom-
plete efficacy is actually achieved in clinical practice. Talley
et al's costs were measured accurately by applying correc-
tion factors ... Intracoronary thrombolysis was used in 42% of
patients later randomized to IABP therapy compared to
46% of patients in the standard therapy arm. Intravenous
heparin was use...
... were
ED12C (AGTGCTTCCTGCTGCTCCCA) and ED31C
(CCATTACACAGGCCTGTCCAAAG) and the second
round primers used were DR7C (TCAACTCAACTGGTC-
CAAAG) and DR8C (CACTTCTCCAATTGTCCCTCA) that
yield data on 694 ... our
data using only the information gained from pol data
strata and ignoring the env sequence data strata. In other
cases, we form a subsample at random. For example, to
simulate what we h...
... not
participating in this dataset. A total of 72 traumatic brain inju-
ries are described, of whom 32 were transferred to a neurosur-
gical centre. There appeared to be a regional variation in
transfer ... readmission rate to the ICUs
was 7.5%, with a mortality of 23%. Analysis of the major dis-
ease categories in the audit dataset revealed mortality rates of
32.3% for...
... reduced ability to carry out daily tasks was
merely a consequence of pain severity had to be reconsid-
ered. Several studies have indicated that pain-related fear
is one of the most potent predictors ... good for your health? Haworth Pastoral Press,
Binghampton: NY; 1997.
39. Fayad F, Lefevre-Colau MM, Poiraudeau S, Fermanian J, Rannou F,
Wlodyka Demaille S, Benyahya R, Revel M:...
... nasal discharg e and coughing)
and rectal temperatures were recorded daily for 14 days
post-inoculation (DPI), and nasal swab samples for the
detection of viral shedding were also collected daily ... tudy, while 3 dogs lacked
symptoms. All of the animals seroconverted a s assessed
by a CIV competitive ELISA (data not shown). Clinical
signs were observed from 4 to 8 DPI, and viral...