Báo cáo y học: "Sequential gene profiling of basal cell carcinomas treated with imiquimod in a placebo-controlled study defines the requirements for tissue rejection" pps
Báo cáo y học: "Sequential gene profiling of basal cell carcinomas treated with imiquimod in a placebo-controlled study defines the requirements for tissue rejection" pps
... secondary. Finally, the same genes were also compared to a database of IFN-α-associated transcripts as described in the Materials and methods. In the same panel the 637 genes are shown in a supervised-sample ... informationOpen Access2007Panelliet al.Volume 8, Issue 1, Article R8ResearchSequential gene profiling of basal cell carcinomas treated with imiquimod in a placebo-controlled study defines the ... list of the 637 genes specifically inducedby imiquimod treatment based on the statistical approachpresented in the text. Additional data file 4 is a diagramillustrating the mining strategy that...
- 15
- 339
- 0
Báo cáo y học: "Pro-inflammatory properties of stromal cell-derived factor-1 (CXCL12) in collagen-induced arthritis" pptx
... CXCL12 acts as a pro-inflammatory factor in the pathogenesis of autoimmunearthritis by attracting inflammatory cells to joints and bystimulating the differentiation and activation of osteoclasts.IntroductionAmong ... the chemokine family, CXCL12 may play a role in inflammatory dis-eases. Specifically, there is increasing evidence that CXCL12plays a crucial role in patients with rheumatoid arthritis (RA). In RA patients, ... and the area of the pit correlates with osteoclast activity. The mean area of the resorption pits in the different conditions was calculated using a bioquant image analysis system (the data are...
- 13
- 356
- 0
Báo cáo y học: "An experimental model of rhinovirus induced chronic obstructive pulmonary disease exacerbations: a pilot study" pps
... functionchanges typical of naturally occurring exacerbations.These were associated with evidence of viral replicationand inflammatory cytokines in the upper airway. Thesefindings suggest experimental ... spirometry and nasal lavagewere performed and blood drawn for baseline serology. The subjects were seen daily for clinical review and nasallavage on the 8 days post-inoculation and on day 11.Clinic ... Corresponding author AbstractBackground: Acute exacerbations of COPD are a major cause of morbidity, mortality andhospitalisation. Respiratory viruses are associated with the majority of exacerbations...
- 10
- 320
- 0
Báo cáo y học: "Differential gene expression of bone anabolic factors and trabecular bone architectural changes in the proximal femoral shaft of primary hip osteoarthritis patients" pptx
... specimens. The authors thank Professor David M Findlay (Department of Orthopaedics and Trauma, Royal Adelaide Hospital, Adelaide, Australia) for the kind use of his laboratory for the undertaking of ... GTCAGCCAACTCGTCACAGTCCOPNSense AGCCGTGGGAAGGACAGTTATG 472 62 29 NM_000582Antisense GAGTTTCCATGAAGCCACAAACIGF-ISense GAGCCTGCGCAATGGAATAAAG 344 62 33 NM_000618Antisense CCTGTCTCCACACACGAACTGIGF-IISense GAGGAGTGCTGTTTCCGCAG ... significance level of data for both OA and control groups.Data analysis The data generated were tested for normality using the Sha-piro-Wilk statistic. The statistical significance of the differencebetween...
- 12
- 421
- 0
Báo cáo y học: "Global fitness profiling of fission yeast deletion strains by barcode sequencing" pptx
... 5'-AGCAGAAGACGGCATACGAGCCTTACT-TCGCATTTA-3'. For dntags, the forward primer (dnf-X)was 5'-CACGACGCTCTTCCGATCTXXXXCCAGT-GTCGAAAAGTATC-3', and the reverse primer (dnr)was ... normalized by total matched reads of the version 1.0 strains. Only uptag reads of the rad32 strain are plotted here. See Additional file 8 for the dntag reads of the rad32 strain and the barcode ... independent profiling assays hasprovided phenotypic evidence potentially linking a largenumber of genes to mitosis and DDR, including manygenes without a GO term annotation associating them with these...
- 13
- 442
- 0
Báo cáo y học: "Digital expression profiling of novel diatom transcripts provides insight into their biological functions" doc
... 318:245-251.24. Matsuzaki M, Misumi O, Shin-I T, Maruyama S, Takahara M, Miyagishima SY,Mori T, Nishida K, Yagisawa F, Yoshida Y, Nishimura Y, Nakao S, Kobayashi T,Momoyama Y, Higashiyama T, Minoda A, Sano ... Tanaka Y, Nakatsuma D, Harada H, Ishida M, Matsuda Y: Localization of soluble beta-carbonic anhydrase in the marine diatom Phaeodactylumtricornutum. Sorting to the chloroplast and cluster formation ... K,Hayashi H, Ohta F, Nishizaka S, Haga S, Miura S, Morishita T, Kabeya Y, Terasawa K, Suzuki Y, Ishii Y, Asakawa S, et al: Genome sequence of the ultrasmall unicellular red alga Cyanidioschyzon...
- 19
- 457
- 0
Báo cáo y học: "Stable gene transfer of CCR5 and CXCR4 siRNAs by sleeping beauty transposon system to confer HIV-1 resistance" doc
... (5'-GATCCATGGTTGTTAGGACCTGGAG-GGGAAATCAATCCCCT-3', 5'-phosphate) was used for left IR/DR and splink SphI (5'-GTTGTTAGGACTGCTT-GGAGGGGAAAATCAATCAATCCCCT-3', 5'-phosphate)was used for ... resistanceMayur Tamhane and Ramesh Akkina*Address: Dept. Microbiology, Immunology and Pathology, Colorado State University, Fort Collins, Colorado, 80523, USAEmail: Mayur Tamhane - mayur@colostate.edu; ... toderive viral resistant cells and paved the way for the use of this system for HIV gene therapy studies.Competing interests The authors declare that they have no competing interests.Authors'...
- 9
- 355
- 0
Báo cáo y học: " Multi-analyte profiling of ten cytokines in South African HIV-infected patients with Immune Reconstitution Inflammatory Syndrome (IRIS)" pdf
... IFN-g, and TNF -a) were analysed using a HumanCytokine 10-Plex Th1/Th2 assay (Bio-Rad, California,USA) and Luminex multi-analyte profiling technology(Bio-Rad, USA) accordin g to manufactu rer instructions.Plasma ... entered for each cytokine tested. Sam-ple information was entered; a ll standards and sampleswere assayed concurrently, on the same plates, in orderto avoid intra-assay variability.Statistical analysisMedian ... loss of CD4+T cellsand eventually to the onset of AIDS [1]. Highly activeantiretroviral therapy (HAART) results in a dramaticreduction in AIDS-defining illnesses and mortality byinhibiting...
- 7
- 340
- 0
Báo cáo y học: "NSP2 gene variation of the North American genotype of the Thai PRRSV in central Thailand" ppt
... Wassenaar AL, Spaan WJ, Gorbalenya AE, Snijder EJ: Alternative proteolyticprocessing of the arterivirus replicase ORF 1a polyprotein: evidence thatNSP2 acts as a cofactor for the NSP4 serine protease. ... andNorth American (Type 2) genotype, respectively and displays a large degree of genetic variability, particularly at the nonstructural protein (nsp) 2 gene. This is the first study determining genetic ... his study. All samples were obtained fromPRRSV-affected farms, located in the central region, anarea of Thailand with a large pig population. Accordingto the farm history, Type 2 PRRSV infection...
- 6
- 344
- 0
Báo cáo y học: " Global expression profiling of theophylline response genes in macrophages: evidence of airway anti-inflammatory regulation" ppsx
... AGTGTGCCTATTCCCTGAAAGATIL-13 F155: TGAGGAGCTGGTCAACATCA 76R230: CAGGTTGATGCTCCATACCATIL-18 F211: GCTGAACCAGTAGAAGACAATTGC 94R304: CCAGGTTTCATCATCTTCAGCTAIL-13Rα1 F495: GGAATACCAGTCCCGACACTAACT ... cAMP pathway and further inhibits the expression of LTC4 and LTD4.ConclusionThese data may facilitate the understanding of the diverseanti-inflammatory effects of theophylline, as well as the potential ... GGAATACCAGTCCCGACACTAACT 93R587: GGCCTTCTCTAAAGATGTTTTCACAIL-13Rα2 F44: GGCTATTTGAAGTCGCCATAACC 78R121: AGATTTAAAACCTTGATATTGCCTCTCTTNF-α F414: CTCGAACCCCGAGTGACAA 64R477: AGCTGCCCCTCAGCTTGAVEGF -a F1200: AACACACACTCGCGTTGCAA...
- 12
- 237
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ