Fame is a bubble, but not for some Gregory A Petsko pptx
Fame is a bubble, but not for some Gregory A Petsko pptx
... seems, can be pretty fleeting. But not for a few, and Crick clearly was one of those. Ithelped that he was part of a revolution: paradigm shifts have a way of conferring name recognition that lasts ... won thatvery prize for liquefying helium? My guess is that at leasthalf of the Nobel laureates are not recognizable names to a majority even of scientists in the same broad field. Immor-tality, ... deserved a free pass, it certainly would be Francis Crick. Which brings me to the main point of this essay. I hadn’tmeant for it to be an obituary because, to be frank, his mon-umental accomplishments...
- 2
- 153
- 0
Blackwell Science, Ltd Group breeding dramatically increases reproductive success of yearling but not older female scrubwrens: a model for cooperatively breeding birds? ppt
... territory quality (categorical variables),and male age and age squared (continuous variables).Age and age-squared were used in case the effect ofmale age was not a monotonic increase. There was noeffect ... only entail a single season for an individual as a yearling, but couldpotentially entail multiple years for an ‘older’ female.To avoid repeated measures from older females, and tomake data directly ... to Australia, placed either inthe family Acanthizidae (Schodde & Mason 1999),or included in the subfamily Acanthizinae in thePardalotidae (Christidis & Schodde 1991; Christidis &Boles...
- 16
- 337
- 0
Báo cáo khoa học: Insulin is a kinetic but not a thermodynamic inhibitor of amylin aggregation pot
... amylin to evaluate its effect onamylin aggregation. Samples were incubated at 37 °C for 72 h with shaking, and were taken for ThT assays, light scat-tering assays and HPLC analysis at selected ... insulin may be not only a natural inhibi-tor of amylin aggregation, but also a contributor tothe amyloid formation and pathogenesis of T2D. Wealso found that the promotional effects were caused ... componentof islet amyloid [15]. Thus, extracellular amyloid,which is the major part of islet amyloid, may possiblybe formed by more complicated mechanisms. However,insulin may still act as a contributor...
- 7
- 388
- 0
Báo cáo hóa học: " Dual-task costs while walking increase in old age for some, but not for other tasks: an experimental study of healthy young and elderly persons" pdf
... avoiding obstacles, engaged in a visual checkingtask, and/or kept a visual scene in memory. The walkingand each non-walking task were administered separatelyas well as concurrently. For task ... indicators are 20% of the corresponding standard deviation. An age-related deficit of dual-task performance exists where grey bars are larger than black bars.010203040walk+spellwalk+shapewalk+buttonwalk/n+shapewalk/n+buttonwalk/nf+shapew a lk/nf+buttontreadmill/o+detectwalk/o+memowalk+chech/gwalk+check/gwwalk/o+check/gwalk/o+check/gwmean ... purposes)Journal of NeuroEngineering and RehabilitationOpen AccessResearchDual-task costs while walking increase in old age for some, but not for other tasks: an experimental study of healthy young and...
- 9
- 481
- 0
báo cáo khoa học: " Ornithine-δ-aminotransferase is essential for Arginine Catabolism but not for Proline Biosynthesis" ppsx
... 5'gtcccatatagttgagccattc for oat1 and oat2; Oat-f2: 5'gctttcatggacgtacattag, Oat-r2:5'caagtatcaccatgtcaggac for oat3; the T-DNA left borderspecific primer was 5'ttcggaaccaccatcaaacag. None of ... demonstrating that δOAT-activity is not essential for the normal life cycle of Arabidopsis (data no shown).δOAT is localised in mitochondriaFigure 1δOAT is localised in mitochondria. Leaf protoplasts ... pyrroline-5-carboxylate (P5C), is localised in mitochondria and is essential for Arg catabolism. Wildtype plants could readily catabolise supplied Arg and Orn and were able touse these amino acids as...
- 14
- 463
- 0
Báo cáo y học: " The formation of cysteine-linked dimers of BST-2/tetherin is important for inhibition of HIV-1 virus release but not for sensitivity to Vpu" potx
... HeLa mRNA using the primers5' ATAAC TCGAG GTGGA ATTCA TGGCA TCTAC TTCGTATGAC TATTGC and 3' AAGCT TGGTA CCTCA CTGCAGCAGA GCGCT GAGGC CCAGC AGCAC. The resultingPCR product was cleaved ... writing the manu-script. EM performed biochemical and FACS analyses andhelped with data analysis. SK assisted with BST-2 muta-genesis and biochemical analyses. KS coordinated andsupervised the ... Sugden A, Wilde A, Banting G:Bst-2/HM1.24 is a raft-associated apical membrane proteinwith an unusual topology. Traffic 2003, 4:694-709.32. Sakuma T, Noda T, Urata S, Kawaoka Y, Yasuda J: Inhibition...
- 16
- 275
- 0
Báo cáo y học: "Intensive care acquired infection is an independent risk factor for hospital mortality: a prospective cohort study" pot
... a favorable response toantimicrobial therapy.Data registration and statistical analysisData were collected daily by one of the authors (PY) andentered into an SPSS database (SPSS Data Entry, ... infection on admission in general was not a risk factor for hospital mortality in univariate analysis, community-acquired pneumonia was clearly associated with increasedmortality. In an earlier retrospective ... scores at 3 or 7 days before the onset of nosocomialbacteremia, there was only a trend toward catheter-relatedsepticemia-attributable mortality [6]. Our multivariate analysisshowed that an ICU-acquired...
- 6
- 259
- 0
Tài liệu A COMPREHENSIVE QUANTITATIVE MODEL FOR ANALYZING BOND REFUNDING DECISIONS pptx
... refunding analysis that has not been adequately treated to date is the analysis of a bond refundingproposal with overlapping interest. For example, although Maris [6] included overlapping interest ... replaced by a floating-rate bond, a floating-rate bond replaced by a fixed-rate bond,and a floating-rate bond replaced by another floating-rate bond with a different index or a different margin.MOTIVATION ... be adjusted semiannually with a 1% semiannual margin and a life-time ceiling of 4% above the initial index. Other information about this bond issue is exactly as described above. In this case...
- 9
- 357
- 1
The natural history of non-alcoholic fatty liver disease in children: a follow-up study for up to 20 years pptx
... liver biochemistries (serum aspartate aminotransferase(AST), alanine aminotransferase (ALT), alkaline phosphataseactivity, c-glutamyl transferase (GGT), total bilirubin, albuminlevels and prothrombin ... each individual case.{Includes the normal laboratory values for boys and girls for the age range of our patient population.{Based on percentile for age and sex.ALT, alanine aminotransferase; ... which is a database of medicalrecords of every patient seen at Mayo Clinic. Eachunit medical record contains all inpatient andoutpatient medical information for each patientseen at Mayo Clinic...
- 7
- 487
- 0
Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ