0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo sinh học: "Prediction error variance and expected response to selection, when selection is based on the best predictor for Gaussian and threshold characters, traits following a Poisson mixed model and survival traits" potx

Báo cáo sinh học:

Báo cáo sinh học: "Prediction error variance and expected response to selection, when selection is based on the best predictor for Gaussian and threshold characters, traits following a Poisson mixed model and survival traits" potx

... expected response to selection, when selection is based on the best predictor - for Gaussian and threshold characters, traits following a Poisson mixed model and survival traits Inge Riis KORSGAARD a , Anders ... expected response to selection on the additive genetic scale and on the observed scale. The expressions given for non Gaussian traits are generalisations of the well-known formulas for Gaussian traits ... - and reflect, for Poisson mixed models and frailtymodels for survival data, the hierarchal structure of the models. In general the ratio of the additive genetic variance to the total variance...
  • 27
  • 254
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Research Article Approximation of Solution of Some m-Point Boundary Value Problems on Time Scales Rahmat Ali Khan1 and Mohammad Rafique2 1" pot

... Quasilinearization for Nonlinear Problems, vol. 440 ofMathematics and Its Applications, Kluwer Academic Publishers, Dordrecht, The Netherlands, 1998.25 V. Lakshmikantham and A. S. Vatsala, “Generalized ... 2001.Advances in Difference Equations 116 D. Anderson, R. Avery, and J. Henderson, “Existence of solutions for a one dimensional p-Laplacian on time-scales,” Journal of Difference Equations and Applications, ... m-PointBoundary Value Problems on Time ScalesRahmat Ali Khan1 and Mohammad Rafique21Centre for Advanced Mathematics and Physics, National University of Sciences and Technology (NUST),H-12, Islamabad 46000,...
  • 11
  • 328
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Transcription in mosquito hemocytes in response to pathogen exposure" ppt

... that theyare unable to transmit disease-causing pathogens, and to mass release them into the environment to displace naturalpopulations of susceptible mosquitoes. Before such a strategy can ... eexxppaannddeedd ppaatttteerrnn rreeccooggnniittiioonn ccaappaacciittyy aaggaaiinnsstt bbaacctteerriiaa aannddmmaallaarriiaa ppaarraassiitteess J Biol Chem 2009, 228844::9835-9844.11. Dong Y, Aguilar R, ... elicits a weaker response than infection with livingbacteria. Furthermore, given that the rodent malaria parasitePlasmodium berghei and the human malaria parasitePlasmodium falciparum elicit...
  • 4
  • 287
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " A strategy of tumor treatment in mice with doxorubicin-cyclophosphamide combination based on dendritic cell activation by human double-stranded DNA preparation" doc

... study and performed the statistical analysis. EVD carried out the mice experiments and performed the statistical analysis. ASP carried out the mice experiments and drafted the manuscript. KEO participated ... human dsDNA preparation 1day ( on the day of CP injection), 3, 4, and 5 days afterCP treatment. Three, 6, and 9 days later, the fraction ofmononuclear cells (MNCs) was isolated from spleen and bone ... suggestingthat the integration of cytostatics with dsDNA prepara-tion may be a treatment modality for enhancing regres-sion of established tumors.According to the data in the literature a combinationof...
  • 10
  • 254
  • 0
Báo cáo y học:

Báo cáo y học: "Broader HIV-1 neutralizing antibody responses induced by envelope glycoprotein mutants based on the EIAV attenuated vaccin" ppt

... persisten ce and pathogenesis are very similar [3,4]. These similarities are based on the common genetic organization, the molecu-lar mechanism of viral replication, and the conforma-tional ... GCTCTAGAGATATCGACACCATGGACAGGGCCAAGCTGCTGCTGCN54145R GTGAACAGGGTGAGGCAGGGCTACTGAGGATCCGTCGACCG145M1u ACCACCGAGTTCTGCGCCAGCGACG145M1d CGCAGAACTCGGTGGTGGTGGCGCCCTTCCACACGG145M2u AACCAGGACACCTACCACGAGACC145M2d ... DNA vaccine and recombinant vaccinia vaccineby introducing all of the EIAV amino acid mutations(Table 1 and Figu re 1b). They were based on the struc-tural information of the attenuated EIAV...
  • 13
  • 307
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Estimation of variance components of threshold characters by marginal posterior modes and means via " pptx

... to the variance of the sample mean computed from the estimated autocorrelations (Sorensen et al,1995). Autocovariance for lag t was estimated as Variance of sample mean ... applied to parameters and liabil-ities was implemented for Bayesian analysis of a binary trait. A simulation studywas conducted to evaluate the accuracy of 3 estimators ... and randomeffects and the variance components in a hierarchical Bayes LMM to be proper,ie integrable. One condition was that for any variance component j, besides the residual,...
  • 22
  • 237
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Prediction of genetic gains in body weight, egg production and shell quality traits in the Brown Tsaiya laying duck" pps

... females and 624 males), separately for males and females with the assumption E(B) = B. This assumption is more valid when there is a large numberof animals. Theoretically, ... applied to a multiple traitanimal model based on data of the first five generations of selection. The selection goals of this breeding program at present are to maintain ... TLRI) and SAGA for their help in carrying out this research and alsoINRA-SAGA and COA-TLRI for their financial support.h and ES30 or ES40 are phenotypically uncorrelated,...
  • 13
  • 305
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Inferences about variance components and selection response for body weight in chickens" pdf

... Mueller and James, 1983). Therefore, an evaluationof genetic variation and of selection response in populations with a long history of selection for growth rate is necessary ... average selection intensity over sexes and generations was approximately onephenotypic standard deviation. The approximate formula for predicting response to selection based ... and a non-genetic component is therefore not possible using the leastsquares approach. The above mentioned comparison is therefore less valuable as a diagnostic tool to...
  • 13
  • 273
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Prediction of plant promoters based on hexamers and random triplet pair analysis" ppt

... crossvalidation.Rank Random Triplet Pair(RTP)1 AAA-AAA2 AAA-AAT3 AAA-AGA4 AAA-ATC5 AAA-ATT6 AAA-CAT7 AAA-TTT8 AAC-ATA9 AAC-CGA10 AAC-CTGAzad et al. Algorithms for Molecular Biology ... crossvalidation.Rank Common hexamers extracted from All 5 dataset (top 25%)1 ATATAT2 TATATA3 ATATTT4 TATAAA5 AAAAAA6 TTTTTT7 AGAGAG8 TCTCTC9 CTCTCT10 GAGAGAAzad et al. Algorithms for ... feature selection and the 5-fold cross-validation test for each case. The overall performance using rRNA was the best for both algorithms among the sampled ones. The reason for such high performance...
  • 10
  • 309
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Prediction of haplotypes for ungenotyped animals and its effect on marker-assisted breeding value estimation" ppsx

... usedas nhc and the variance is the same as for NM. For CON-BLUP, Equation (3) is used without regression on nhc and the variance of the additive genetic effect is set to . For all evaluations, mixed ... contributionsHAM developed the method, ran the simulations and evaluations and drafted the manuscript. MPLC and RFV discussed the method and results and helped to draft the manuscript. All authors ... shows the accuracy of QTL-EBV (panel A and B) and total EBV (Panel C and D) for genotyped males(panel A and C) and ungenotyped females (panel B and Figure 1 Mean proportion of QTL -variance explained...
  • 15
  • 384
  • 0

Xem thêm

Từ khóa: báo cáo sinh học phân tửbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ