Báo cáo y học: " Comparative and functional genomics reveals genetic diversity and determinants of host specificity among reference strains and a large collection of Chinese isolates of the" ppt
Báo cáo y học: " Comparative and functional genomics reveals genetic diversity and determinants of host specificity among reference strains and a large collection of Chinese isolates of the" ppt
... R218Research Comparative and functional genomics reveals genetic diversity and determinants of host specificity among reference strains and a large collection of Chinese isolates of the phytopathogen ... strain8004 and investigated the genetic diversity and host specificity of Xcc by array-based comparative genome hybridization analyses of 18 virulent strains. The results demonstrate that a genetic ... JLperformed plant assays. LZ, WJ and YQH performed the bio-informatic analysis. JLT, YQH and BC performed CC and other data analyses. JLT, YQH and LZ wrote the paper. Allauthors have read and approved...
- 26
- 322
- 0
Báo cáo y học: "Comparative study on saponin fractions from Panax notoginseng inhibiting inflammation-induced endothelial adhesion molecule expression and monocyte adhesion" docx
... ICAM-1 AGACACAAGCAAGAGAAGAA GAGAAGCCCAAACCCGTATG 234 NM_012967.1 VCAM-1 GGAGCCTGTCAGTTTTGAGAATG TTGGGGAAAGAGTAGATGTCCAC 105 NM_012889.1 GAPDH TGCACCACCAACTGCTTAG AGTGGATGCAGGGATGATGT 180 NM_017008 ... was prepared by a Milli-Q purification system (USA). Animals and treatment Male Sprague-Dawley rats (170±10g), purchased from Guangdong Provincial Medical Laboratory Animal Center (China), ... protein family, namely VCAM-1 and ICAM-1, were investigated in this study. It has been reported [20, 21] that antioxidant agents such as PDTC and proanthocyanidin extract markedly attenuate the...
- 37
- 309
- 0
Báo cáo y học: "Most recent developments in strategies to reduce the progression of structural changes in osteoarthritis: today and tomorrow" doc
... disease-modifying potential of theseagents in OA.Intra-articular treatments: steroids and hyaluronic acidThe pain and secondary inflammation in OA can be effectivelyrelieved by intra-articular ... hyaluronic acid treatment. A local disease such as knee OA may mandate a localtherapy such as intra-articular injections. Only one study haslooked at the long-term impact of repetitive intra-articularsteroid ... such enzymes were found inarticular tissues and named aggrecanase-1 and aggrecanase-2 [83,84]. These enzymes belong to the ADAMTS family and were further designated ADAMTS-4 and ADAMTS-5,respectively....
- 14
- 420
- 0
Báo cáo y học: " Improved vaccine protection against retrovirus infection after co-administration of adenoviral vectors encoding viral antigens and type I interferon subtypes" ppsx
... necrosis factor alpha(TNF -a) and either PerCP-anti-CD8 or PerCP-anti-CD4(all from Becton Dickinson, Heidelberg, Germany) and analyzed by flow cytometry.Statistical analysesStatistical analyses ... efficacy of replicase-based DNAvaccines. Vaccine 2006, 24:5110-5118.31. Day SL, Ramshaw IA, Ramsay AJ, Ranasinghe C: Differential effects of thetype I interferons alpha4, beta, and epsilon on antiviral ... Iwanami N, Niwa A, Yasutomi Y, Tabata N, Miyazawa M: Role of naturalkiller cells in resistance against friend retrovirus-induced leukemia. J Virol2001, 75:3152-3163.36. Miyazawa M, Fujisawa...
- 15
- 277
- 0
Báo cáo y học: " Drug metabolizing enzyme activities versus genetic variances for drug of clinical pharmacogenomic relevance" pot
... that may or may not affectcatabolic rates. For many genes, there are a large number of variants. It is not practicalor necessary to phenotypically characterize each variant, and only polymorphisms ... used clinical practicetoday. CYP 2D6 hydroxylates aromatic rings or an accompanying short side-chain of basic aryl-alkyl amines containing a protonated nitrogen. Of all enzymes of pharmaco-kinetic ... incidence and where data is available will be discussed.CYP 2D6CYP 2D6 is also known as debrisoquine hydroxylase that catalyzes the oxidation of approximately a quarter of all the commonly therapeutic...
- 9
- 262
- 0
Báo cáo y học: " Using Geographic Information Systems (GIS) to assess the role of the built environment in influencing obesity: a glossary" pptx
... specific walkableland uses (e.g. parks) may be more important than hav-ing equal amounts of different land uses in an area [63].GIS enables the integration of land use data from a range of sources ... theo-retically-informed rather than data-driven analyticalapproaches [75].AcknowledgementsLT is currently supported by an Australian National Health and MedicalResearch Council (NHMRC) Capacity Building Grant ... routes.Thornton et al. International Journal of Behavioral Nutrition and Physical Activity 2011, 8:71http://www.ijbnpa.org/content/8/1/71Page 5 of 9accurate network data are available. Measures of traveltime...
- 9
- 423
- 0
Báo cáo y học: "Comparative genomics reveals a constant rate of origination and convergent acquisition of functional retrogenes in Drosophila" pptx
... Assembly/Alignment/Annotation of 12 related Drosophilaspecies: Comparative Analysis Freeze 1 [http://rana.lbl.gov/drosophila]48. Adams MD, Celniker SE, Holt RA, Evans CA, Gocayne JD, Amanati-des ... MA: Conservation of intron position indicates separation of major and variantH2As is an early event in the evolution of eukaryotes. J MolEvol 1990, 30:449-455.15. Zhang Z, Inomata N, Yamazaki ... D.sechellia and D. mauritiana). In that study, we also inferredthat retroposed copies of Cervantes also originated in the lin-eages leading to D. yakuba and D. erecta and this occurredindependently...
- 9
- 406
- 0
Báo cáo y học: "Comparative genomics reveals 104 candidate structured RNAs from bacteria, archaea, and their metagenomes" pot
... Enterococcus faecium RF01760Transposase-resistance ? y n Several phylaTwoAYGGAY y n n Human gut, g-Proteobacteria, ClostridialeswcaG Y y y Marine, cyanophage RF01761Whalefall-1 Y n n Whalefall only RF01762yjdF ... linkagegeometry and the stability of RNA. RNA 1999, 5:1308-1325.28. Ueland PM: Pharmacological and biochemical aspects of S-adenosylhomocysteine and S-adenosylhomocysteine hydrolase.Pharmacol ... RF01687Actino-pnp Y Y N Actinomycetales RF01688AdoCbl-variant Y Y Y Marine RF01689asd Y ? ? Lactobacillales RF01732atoC y y?δ-Proteobacteria RF01733Bacillaceae-1 Y n n Bacillaceae RF01690Bacillus-plasmid...
- 17
- 361
- 0
Báo cáo y học: "Comparative genomics reveals birth and death of fragile regions in mammalian evolutio" pdf
... (for adjacent branches like M+ and R+), green (for branches that are separated by a single branch like M+ and D+ separated by MR+), and yellow (for branches that are separated by two branches ... same wayas the Nadeau-Taylor ‘exponential length distribution test’was applied in numerous papers. The Nadeau-Taylor testtypically amounted to constructing a histogram of syntenyblocks and ... this article as: Alekseyev and Pevzner: Comparative genomics reveals birth and death of fragile regions in mammalian evolution.Genome Biology 2010 11:R117.Alekseyev and Pevzner Genome Biology...
- 15
- 384
- 0
Báo cáo y học: "Comparative genomics of the social amoebae Dictyostelium discoideum and Dictyostelium purpureum" ppt
... AGTTCCTTCATTCT AAGAAAACC TCCGTCAACDd_r28 GTTGACCTTACAGCAATCTAATC ACAAATTTTTACTTCAC AAAAAAAAAACCCCTTCGTCAACDd_r41 GTTGACCTTACAGCAAATCTTAA AGCTACTTCATTCT AAGAAAAAC TCCTGTCAACDd_r47 GCTGACCTTACAGCAATTCTATC ... ATTCAAAATTTAAC TCTGAAAT CTTGAATTCDp_11 GAATTCCTTACAGCAATTAAACT C ATTCAAAATTTAAC TCTGAAAT CTCGAATTCDp_19 GAATTCCTTACAGCAATAAACTT GACTCTGAAATCTT AAATTCDp_2 GAATTCCTTACAGCAATTA-CAT TATTGAAGAAACCT GAATTCDp_20 ... G-ATTTTTCTCCAA AAAAAAAAC CTTCGCGAGTDd_r36 GCTGCGCTTACAGCAATTACTCT GAATTTTTCTCCAA AAAAAAACC CTTCGCGAGTDp_1 GAATTCCTTACAGCAATGA CT CATCTGAAACCCTT GGATTCDp_10 GAATTCCTTACAGCAAT ATAA C ATTCAAAATTTAAC TCTGAAAT...
- 23
- 481
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM