0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: " Nebulized heparin is associated with fewer days of mechanical ventilation in critically ill patients: a randomized controlled trial" potx

Báo cáo y học:

Báo cáo y học: " Nebulized heparin is associated with fewer days of mechanical ventilation in critically ill patients: a randomized controlled trial" potx

... 0.02). Heparin administration was not associated with any increase in adverse events.Conclusions: Nebulized heparin was associated with fewer days of mechanical ventilation in critically ill patientsexpected ... nebulized heparin on the lungs by measuring systemic APTTlevels and also markers of coagulation act ivation in pul-monary lavage fl uid. Nebulized heparin was associated with a systemic anti-coagulant ... day 1 placebo (24) and heparin (25), day 3placebo (21) and heparin (15), day 5 placebo (19) and heparin (11), and day 7 placebo (13) and heparin (7). Graphs represent mean ± standarderror of...
  • 10
  • 606
  • 0
Báo cáo y học:

Báo cáo y học: "Bench-to-bedside review: Preventive measures for contrast-induced nephropathy in critically ill patients" pps

... in patents who are not critically ill, specifically oral NAC on theday before and on the day of contrast administration, as wellas hydration with bicarbonate. If administration of NAC is notpossible, ... example administration of theophylline (a selectiverenal adenosine antagonist) or of fenoldopam mesylate (a selective dopamine-1 receptor agonist that increaseseffective renal plasma flow without ... subsequent increasedmedullary ischaemia.Another potential approach to preventing contrast-inducednephropathy is the use of haemodialysis or haemofiltration.The half-lives of contrast media are increased...
  • 10
  • 319
  • 0
Báo cáo y học:

Báo cáo y học: "The relationship between gastric emptying, plasma cholecystokinin, and peptide YY in critically ill patients" ppt

... theintra-assay coefficient of variation at 50 pmol/L was 9.5%.Plasma PYY concentrations were measured by radioimmu-noassay using an antiserum raised in rabbits against humanPYY (1–36) (Sigma-Aldrich) ... mediate the initial postprandial release of PYY [9,10]. In healthy humans, exogenous administration of CCK and PYY is associated with relaxation of the proximalstomach, inhibition of antral motor ... IL,USA).Statistical analysisData are presented as mean ± standard error of the mean. Theintegrated changes in plasma concentrations of CCK and PYYwere calculated and expressed as areas under...
  • 9
  • 338
  • 0
Báo cáo y học:

Báo cáo y học: "Rheumatoid cachexia is associated with dyslipidemia and low levels of atheroprotective natural antibodies against phosphorylcholine but not with dietary fat in patients with rheumatoid arthritis: a cross-sectional study" pdf

... statistical analysis.ResultsDietary intake and fatty acid profilesThe mean dietary intake of total energy, carbohydrate, proteinand fat is shown in Table 2. Compared with the Swedish FoodRecommendations ... energy percentage; FA, fatty acid; MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acid; SFA, saturated fatty acid.Available online http://arthritis-research.com/content/11/2/R37Page ... AN, Papavasiliou EC, Lourida ES, Alamanos Y, KostaraC, Tselepis AD, Drosos AA: Atherogenic lipid profile is a featurecharacteristic of patients with early rheumatoid arthritis: effect of early...
  • 11
  • 549
  • 0
Báo cáo y học:

Báo cáo y học: " Food assistance is associated with improved body mass index, food security and attendance at clinic in an HIV program in central Haiti: a prospective observational cohort study" docx

... care by impacting a bility to take antire-troviral medications in a number of ways, includingcausing symptoms of nausea while taking medicationson an empty stomach, increasing drug toxicity, ... I, et al: Adherence to antiretroviral therapy in Sub-Saharan Africa and North America: a meta-analysis. JAMA 2006,296(6):679-90.37. Bassett I, Wang B, Chetty S, et al: Loss to care and death ... this article as: Ivers et al.: Food assistance is associated with improved body mass index, food security and attendance at clinic in anHIV program in central Haiti: a prospective observational...
  • 8
  • 438
  • 0
Báo cáo y học:

Báo cáo y học: "Preoperative statin is associated with decreased operative mortality in high risk coronary artery bypass patients" pot

... osis of coronary artery disease and the statin is not alwaysstarted before operation, especially in the urgent orTable 2 Study Population and results of bnivariateanalysis of statin groupsAll ... study design, manuscript preparation, andpresentation at national meeting. DAD assisted in study design andstatistical analysis. KAS developed the database and performed statisticalanalysis. ... Mangano DT: Preoperativestatin therapy is associated with reduced cardiac mortality aftercoronary artery bypass graft surgery. J Thorac Cardiovasc Surg 2006,132:392-400.11. Magovern JA, Singh...
  • 5
  • 399
  • 0
Báo cáo y học:

Báo cáo y học: "Perceived discrimination is associated with severity of positive and depression/anxiety symptoms in immigrants with psychosis: a cross-sectional study" pot

... Fresan A, De la Fuente-Sandoval C, Loyzaga C, Garcia-Anaya M,Meyenberg N, Nicolini H, Apiquian R: A force d five-dime nsional factoranalysis and concurrent validity of the Positive and NegativeSyndrome ... The same analy-sis using occupational status instead of educational levelshowed that perceived discrimination retained a signifi-cant association with PANSS depression/anxiety symp-toms (Table ... Hospital and the University of Oslo. We declare thatnone of the authors are financially involved or affiliated with anyorganization that may benefit from these findings. We thank all participantsto...
  • 9
  • 451
  • 0
Báo cáo y học:

Báo cáo y học: " Self-esteem is associated with premorbid adjustment and positive psychotic symptoms in early psychosis" doc

... self: a longitudinal study examining self-esteem, paranoia and negativesymptoms in individuals with first-episode psychosis. Early IntervPsychiatry 2011, 5:150-155.30. American Psychiatric Association: ... wasadministered. The investigators had all completed generaltraining and a reliability program with regard to the TOPresearch study. For DSM-IV diagnostics mean o verallkappa with training ... data and drafting themanuscript. JIR has made substantial contribution to conception and design,analysis and interpretation, drafting of the manuscript and have beenrevising it critically...
  • 8
  • 371
  • 0
Báo cáo y học:

Báo cáo y học: " Low hemoglobin is associated with poor functional outcome after non-traumatic, supratentorial intracerebral hemorrhag" docx

... suggesting thatanemia or even relative anemia may not be tolerated in the setting of acute brain injury. In patients with acutebrain injury, physiological compensatory mechanismssuch as an increase ... groups in an univariate analysis. This finding is in line with a recent study including almost 700 patients with non-traumatic ICH investigating the role of anemiaon admission (day 1) on the clinical ... clinical course of acute ICH[33]. Although patients with anemia on admission (25.8% of patients) were at higher risk of death at 30 days in uni-variate analysis, this effect did not persist in a...
  • 8
  • 207
  • 0
Báo cáo y học:

Báo cáo y học: "Repetitive DNA is associated with centromeric domains in Trypanosoma brucei but not Trypanosoma cruzi" pot

... family Trypanosomatidae are thecausative agents of African sleeping sickness (Trypanosomabrucei), American trypanosomiasis (Trypanosoma cruzi)and leishmaniasis (Leishmania spp.), diseases that ... TCTTGATAGGCGCATGTGCATGTAACC and CGAT-GGCGCAAGCAGATAGTTGTTACC. In the case of the T. bru-cei 177 bp repeat [37], a probe was generated using primersATTAAACAATGCGCAGTTAACG and GTGTATAATAGCGT-TAACTGCG. ... 2) using primersACCATGTCCAAATTGATCTGCAAATCA and TAGAAGCAT-TAAATCCCAGCATCAGAC. For T. brucei chromosome 6, weused an intergenic probe (Tb12), which was amplified with primers TCTTGATAGGCGCATGTGCATGTAACC...
  • 14
  • 296
  • 0

Xem thêm

Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenwhat indian tribe is associated with the trail of tearsdietary glutathione intake is associated with decreased risk of oral and pharyngeal cancercytokines chemokines and growth stimulating factors is associated with the depletion of tia proteinsfactors associated with the development of stress fractures in womenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015