0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: " Effects of different fibrinogen concentrations on blood loss and coagulation parameters in a pig model of coagulopathy with blunt liver injury" docx

Báo cáo y học:

Báo cáo y học: " Effects of different fibrinogen concentrations on blood loss and coagulation parameters in a pig model of coagulopathy with blunt liver injury" docx

... work is properly cited.Research Effects of different fibrinogen concentrations on blood loss and coagulation parameters in a pig model of coagulopathy with blunt liver injuryOliver Grottke*1,2, ... effect. In addition, the induction of injurywas performed in anaesthetised healthy pigs. Thus, thephysiological response to such things as pain and inflam-mation may have additional effects on haemostasis,which ... hypotension-induced inflammation, as well as consumption and dilu-tion of coagulation factors [1]. Dilutional coagulopathy may occur after massive blood loss, as crystalloid and col-loid solutions are...
  • 9
  • 420
  • 0
Báo cáo y học:

Báo cáo y học: "Hypoxic conditions increase hypoxia-inducible transcription factor 2α and enhance chondrogenesis in stem cells from the infrapatellar fat pad of osteoarthritis patients" pps

... COL1 0A1 , 5'-TACCTTGTGCCTCCCATTCAA-3' (forward) and 5'-TACAG-TACAGTGCATAAATAAATAATATATCTCCA-3' (reverse);COL1 1A2 , 5'-CCTGAGCCACTGAGTATGTTCATT-3' (for-ward) and 5'-TTGCAGGATCAGGGAAAGTGA-3' ... 5'-CACCAGATATCGACAGAGTGGTCTT-3' (forward) and 5'-CAGGGTTAAAGGCAAAGGGATAA-3' (reverse); SOX9, 5'-CTTTGGTTTGTGTTCGTGTTTTG-3' (forward) and 5'-AGA-GAAAGAAAAAGGGAAAGGTAAGTTT-3' ... 5'-AGA-GAAAGAAAAAGGGAAAGGTAAGTTT-3' (reverse); versi-can, 5'-TGCTAAAGGCTGCGAATGG-3' (forward) and 5'-AAAAAGGAATGCAGCAAAGAAGA-3' (reverse).Immunohistochemical staining of cell aggregate...
  • 9
  • 307
  • 0
Báo cáo y học:

Báo cáo y học: "Type I interferon receptor controls B-cell expression of nucleic acid-sensing Toll-like receptors and autoantibody production in a murine model of lupus" doc

... several key features of humanSLE, including kidney pathology, IFN-I pathway activation,autoantibody production, and induction of apoptosis.Conclusions In summary, our data demonstrate a novel ... conception of the study idea and participated in its design, data analysis, and the writing of the manuscript. Allauthors read and approved the final manuscript.Available online http://arthritis-research.com/content/11/4/R112Page ... USA) on a monthly basis. All animal experimentswere approved by, and performed in compliance with, theguidelines of the Institutional Animal Care and Use Committee.Autoantigen microarraysAntigens...
  • 10
  • 408
  • 0
Báo cáo y học:

Báo cáo y học: "Comparative study between the Hybrid Capture II test and PCR based assay for the detection of human papillomavirus DNA in oral submucous fibrosis and oral squamous cell carcinoma" pdf

... in Allahabad, India. Asian Pac J Cancer Prev 2008, 9(2):263-5.5. Chaudhary AK, Singh M, Sundaram S, Mehrotra R: Role of humanpapillomavirus and its detection in potentially malignant and malignanthead ... of human papillomavirus DNA in oral submucousfibrosis and oral squamous cell carcinomaAjay Kumar Chaudhary1,2*, Shruti Pandya2, Ravi Mehrotra2, Alok C Bharti4, Mangal Singh3, Mamta Singh2*AbstractBackground: ... 1].Detailed clinical examination of each patien t was doneto assess the site, siz e and type of lesions. For confirma-tion of the clinical diagnosis, histopathological examina-tion was carried...
  • 10
  • 453
  • 0
Báo cáo y học:

Báo cáo y học: " Candida soluble cell wall β-glucan facilitates ovalbumin-induced allergic airway inflammation in mice: Possible role of antigen-presenting cells" ppt

... cytokines and chemokines, with a possible link tothe activation of signal transducer and activator of tran-scription (STAT)6 [15], implicating that CSBG caninduce/facilitate allergic airway inflammation, ... groupHistological findings of hematoxylin and eosin (H&E)-stained lungsFigure 2Histological findings of hematoxylin and eosin (H&E)-stained lungs. The 4 groups of mice were intratracheally inoculated ... reported as the mean ± SE using Statview version4.0 (Abacus Concepts, Inc., Berkeley, CA). To examineeach (CSBG and OVA) factor's effect and interaction in thecombination, two-way ANOVA was...
  • 12
  • 246
  • 0
Báo cáo y học:

Báo cáo y học: "Parenteral versus enteral nutrition: effect on serum cytokines and the hepatic expression of mRNA of suppressor of cytokine signaling proteins, insulin-like growth factor-1 and the growth hormone receptor in rodent sepsis" pps

... signaling by a negative feedback loop involving the janus kinase and signaltransducer and activator pathway [12]. Yumet and colleagues[13] have recently shown in rats with abdominal sepsis thattotal ... common cellular receptor. The suppressors of cytokinesignaling (SOCS) proteins are inhibitors of cytokine and GHsignaling via the janus kinase and signal transducer and acti-vator pathway, ... (standard rat chow) was removed on the day of operation, but free access to water was continued. Furtherdoses of intraperitoneal fluid and analgesia were administered24 and 48 hours following...
  • 8
  • 318
  • 0
Báo cáo y học:

Báo cáo y học: "Are bone erosions detected by magnetic resonance imaging and ultrasonography true erosions? A comparison with computed tomography in rheumatoid arthritis metacarpophalangeal joints" pptx

... modalities were evaluated with investigatorsblinded to clinical and other imaging data. Each MCP jointquadrant (radial and ulnar part of the metacarpal head and phalangeal base, respectively) ... [31] involved in the present study, evaluations of magnetic resonance images and the US examination weredone only once. CT, being less validated in RA, was evaluatedby two readers (MØ and MH) in ... Work on standardi-zation of definitions of pathology in musculoskeletal US isbeing done in the setting of the European League AgainstRheumatism (EULAR) Working Party for Ultrasound and OMERACT,...
  • 9
  • 376
  • 0
Báo cáo y học:

Báo cáo y học: "Human meniscus cells express hypoxia inducible factor-1α and increased SOX9 in response to low oxygen tension in cell aggregate culture" ppsx

... CTTGTTTACAGTCTGCTCA-AAATATCTTP4Hα(I) Forward 5'-3' GCAGGGTGGTAATATTGGCATTReverse 5'-3' AAATCAATTCCCTCATCACTGAAAG,P4Hα(II) Forward 5'-3'TTAGCTGTCTAGCGCCTAGCAAReverse ... AGCTTCTGTGGAACCATGGAACOL 2A1 Forward 5'-3' CTGCAAAATAAAATCTCGGTGTTCTReverse 5'-3' GGGCATTTGACTCACACCAGTHIF-1α Forward 5-3' GTAGTTGTGGAAGT-TTATGCTAATATTGTGTReverse 5'-3' ... 5'-3'TGTTTTACAGCTGGTTAATGTG-TTGASOX9 Forward 5'-3'CTTTGGTTTGTGTTCGTGTTTTGReverse 5'-3'AGAGAAAGAAAAAGGGAAAGGTAAGTTTCOL 1A2 , collagen type I alpha 2; COL 2A1 , collagen...
  • 9
  • 356
  • 0
Báo cáo y học:

Báo cáo y học: "Advanced glycation end products induce cell cycle arrest and proinflammatory changes in osteoarthritic fibroblast-like synovial cells" doc

... capacity of AGEs to modulate FLStowards inflammation and cartilage degradation and amplifyOA [17]. As the RAGE gene promoter region contains NFκBbinding sites NFκB activation could increase ... BrdU incorporation was measured by a colorimetric assay as a parameter for DNA synthesis. Forevaluation of cell viability and metabolic activity the MTT assaywas used. The assay is based on the ... AGE-RAGE interaction may initiate inflammatoryresponses. In RA, activated NFκB in FLS is involved in the reg-ulation of inflammatory cytokines, adhesion molecules and matrix-grading enzymes, but...
  • 19
  • 395
  • 0
Báo cáo y học:

Báo cáo y học: "The relationship between disease activity, sleep, psychiatric distress and pain sensitivity in rheumatoid arthritis: a cross-sectional study" docx

... [23-27] among healthy individuals and individuals with non-inflammatory pain syndromes; prevalent among theRA population [5,28-31]; and associated with reported painseverity among RA patients ... predicts pain and not vice versa[57]. However, RA pain differs from fibromyalgia pain becauseRA pain frequently has an inflammatory component. Localized,inflammatory pain may cause sleep disturbance, ... painas a priority. The etiology of RA pain is likely multifactorial,including both inflammatory and non-inflammatory components. In this study, we examine the association between diseaseactivity,...
  • 11
  • 562
  • 0

Xem thêm

Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngChuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM