Báo cáo y học: "The short-term safety and efficacy of fluoxetine in depressed adolescents with alcohol and cannabis use disorders: a pilot randomized placebo-controlled trial" potx

Báo cáo y học: "The short-term safety and efficacy of fluoxetine in depressed adolescents with alcohol and cannabis use disorders: a pilot randomized placebo-controlled trial" potx

Báo cáo y học: "The short-term safety and efficacy of fluoxetine in depressed adolescents with alcohol and cannabis use disorders: a pilot randomized placebo-controlled trial" potx

... Access Research The short-term safety and efficacy of fluoxetine in depressed adolescents with alcohol and cannabis use disorders: a pilot randomized placebo-controlled trial Robert L Findling* 1 , Maria ... overall Table 3: Change in baseline to endpoint in depressive symptomatology and psychosocial functioning Measure characteristic Baseline Flu...
Ngày tải lên : 13/08/2014, 18:21
  • 13
  • 380
  • 0
Báo cáo y học: " No genetic evidence for involvement of Deltaretroviruses in adult patients with precursor and mature T-cell neoplasms" doc

Báo cáo y học: " No genetic evidence for involvement of Deltaretroviruses in adult patients with precursor and mature T-cell neoplasms" doc

... No evidence for HTLV infection among leukaemia patients in Germany. Lancet 1983, 2:1495. 27. Miyoshi I, Hatakeyama N, Murakami K, Sawada T, Takimoto Y: Sézary syndrome in an HTLV-I-seronegative, genome-posi- tive ... assistance. They are indebted to Prof. Harald Stein (Head of the Dept. of Pathology, Charité Campus Benjamin Franklin) for giving them access to lymphoma DNA samples....
Ngày tải lên : 13/08/2014, 09:20
  • 7
  • 428
  • 0
Báo cáo y học: "The triterpenoid CDDO inhibits expression of matrix metalloproteinase-1, matrix metalloproteinase-13 and Bcl-3 in primary human chondrocytes" ppt

Báo cáo y học: "The triterpenoid CDDO inhibits expression of matrix metalloproteinase-1, matrix metalloproteinase-13 and Bcl-3 in primary human chondrocytes" ppt

... expression of MMP-1 and MMP-13 in SW- 1353 cells and in two primary cultures: human primary chondrocytes and OA synovial fibroblasts. We have shown in a quantitative manner that in all three cell types, MMP-1 ... pro-inflammatory cytokines in RA, anti-tumor necrosis factor-α (anti-TNF-α) and anti-inter- leukin 1 (anti-IL-1) therapies can reduce inflammation and retard...
Ngày tải lên : 09/08/2014, 01:23
  • 7
  • 348
  • 0
Báo cáo y học: " Soluble receptor for advanced glycation end products in COPD: relationship with emphysema and chronic cor pulmonale: a case-control study" potx

Báo cáo y học: " Soluble receptor for advanced glycation end products in COPD: relationship with emphysema and chronic cor pulmonale: a case-control study" potx

... data suggest compartmentalization of RAGE ligands in the airway lumen in patients with obstructive lung diseases, and may explain why we did not find any significant increase in the circulating ... lacking transmembrane and cytosolic domains, acts as a decoy receptor for R AGE ligands in the extracellular compart- ment, and is believed to afford protection against inflamma...
Ngày tải lên : 12/08/2014, 13:22
  • 9
  • 417
  • 0
Tài liệu Báo cáo Y học: The glucose-specific carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx

Tài liệu Báo cáo Y học: The glucose-specific carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx

... that dephosphorylation and/ or catalytic turnover of EII Glc , rather than binding of Glc, enhanced the reactivity of Cys421. As Cys421 is the only invariant cysteine in homologous transporters and also the only essential ... examples of the inactivation curves obtained with 1a, iodoacetamide and bromoacetic acid are given in Fig. 3, and the results obtained with all co...
Ngày tải lên : 21/02/2014, 01:21
  • 12
  • 720
  • 0
Tài liệu Báo cáo Y học: The RuvABC resolvasome Quantitative analysis of RuvA and RuvC assembly on junction DNA doc

Tài liệu Báo cáo Y học: The RuvABC resolvasome Quantitative analysis of RuvA and RuvC assembly on junction DNA doc

... GTCGGATCCTCTAGACAGCTCCATGTTCACTGGCACTGGTAGAATTCGGC HJ7 TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCC HJ8 CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGA HJ1 AGAAGCTCCATGTAGCAAGGCTAG HJ2 ... Bio-AATGCTACAGTATCGTCCGGTCACGTACAACATCCAG ASP2 CTGGATGTTGTACGTGACCGGACGATACTGTAGCATT DU1 Bio-GTACGAGCAGCTCCCGGGTCAGTCTGCCTA DU2 TAGGCAGACTGACCCGGGAGCTGCTCGTAC HJ5 Bio-AAAAATGGGTCAACGTGGGCAAAGATGTCC...
Ngày tải lên : 21/02/2014, 01:21
  • 10
  • 672
  • 0
Báo cáo y học: "The 3rd International Meeting on Gene Therapy in Rheumatology and Orthopaedics" pot

Báo cáo y học: "The 3rd International Meeting on Gene Therapy in Rheumatology and Orthopaedics" pot

... salivary glands can be accomplished in a relatively noninvasive manner. Bruce Baum (National Institutes of Health, Bethesda, MA, USA) described the suppression of disease in a murine model of ... transfer approaches, and the potential patient population is very large. Because most conditions are debilitating rather than lethal, safety is a dominating issue that determines...
Ngày tải lên : 09/08/2014, 07:20
  • 6
  • 289
  • 0
Báo cáo y học: "The CRIT framework for identifying cross patterns in systems biology and application to chemogenomics" ppt

Báo cáo y học: "The CRIT framework for identifying cross patterns in systems biology and application to chemogenomics" ppt

... case in terms of the range of available system-wide datasets; however, yeast is a harbinger for other systems. Technological and computational advances are leading to a dramatic increase in system-wide ... patterns in systems biology and application to chemogenomics Tara A Gianoulis 1,2 , Ashish Agarwal 3,4 , Michael Snyder 5 and Mark B Gerstein 3,4,6* Abstract Biologica...
Ngày tải lên : 09/08/2014, 22:24
  • 12
  • 391
  • 0
Báo cáo y học: " Rationale for one stage exchange of infected hip replacement using uncemented implants and antibiotic impregnated bone graft"

Báo cáo y học: " Rationale for one stage exchange of infected hip replacement using uncemented implants and antibiotic impregnated bone graft"

... vancomycin alone and in combination with tigecycline and rifampicin against Staphylo- coccus aureus. J Antimicrob Chemother 2009;63(3):485-8. 40. Gristina AG, Jennings RA, Naylor PT, Myrvik ... side a stem with rectangular diameter may offer several advantages: fixation relies mainly on contact of its medial and lateral edges with original bone while the anterior and...
Ngày tải lên : 26/10/2012, 09:53
  • 6
  • 466
  • 0
Báo cáo khoa học: The natural mutation by deletion of Lys9 in the thrombin A-chain affects the pKa value of catalytic residues, the overall enzyme’s stability and conformational transitions linked to Na+ binding pdf

Báo cáo khoa học: The natural mutation by deletion of Lys9 in the thrombin A-chain affects the pKa value of catalytic residues, the overall enzyme’s stability and conformational transitions linked to Na+ binding pdf

... experimentally. In analogy with the values calculated in enzymatic experiments, an increase of % 0.5 pK units of the His57 in DK9 mutant was also calculated analyzing the NAPAP data set (Table 1C). In ... protonation state of catalytic residues of the enzyme. Abbreviations a- NAPAP, N -a- (2-naphthylsulfonyl-glycyl)-4-amidinophenylalanine-piperidine; Bis-Tris, (2-hydroxyeth...
Ngày tải lên : 07/03/2014, 12:20
  • 11
  • 553
  • 0

Xem thêm

Từ khóa: