Báo cáo y học: "Two discrete events, human T-cell leukemia virus type I Tax oncoprotein expression and a separate stress stimulus, are required for induction of apoptosis in T-cells" pptx

Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk

Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk

... trials indicate that the ZES is safe and reduces the rates of clinical and angiographic restenosis in patients with symptomatic coronary ar- tery disease (CAD; 4). Also the safety and efficacy ... Association; CABG: coronary artery binding graft; CK: creatine kinase; MACE: major ad- verse cardiac events; MI: myocardial infarction; PES: paclitaxel- eluting stent; ZE...
Ngày tải lên : 25/10/2012, 11:18
  • 6
  • 550
  • 0
Báo cáo y học: " Two-stage procedure in the treatment of late chronic hip infections spacer"

Báo cáo y học: " Two-stage procedure in the treatment of late chronic hip infections spacer"

... types of spacers used in the treatment of chronically in- fected THA and conclude that hip spacers are effective in the treatment of hip joint infec- tions. Key words: Total hip arthroplasty; ... according to the sensitivity of the infecting organism but conventionally have to fulfil the criteria estab- lished by Murray [24] including: antibiotic safety,...
Ngày tải lên : 26/10/2012, 09:53
  • 5
  • 549
  • 0
Báo cáo Y học: Two different E2F6 proteins generated by alternative splicing and internal translation initiation ppt

Báo cáo Y học: Two different E2F6 proteins generated by alternative splicing and internal translation initiation ppt

... efcient translation initiation by ribosomal scanning for both E2F6b and E2F6, and suggest that their translation may be initiated internally. Two different E2F6 proteins accumulate in cells If translation ... inhibited cells. E2F6 and E2F6b expression was again analyzed by RT-PCR with Fig. 5. Expression of E2F6 and E2F6b. (A)ExpressionofE2F 6and E2F6b in prim...
Ngày tải lên : 08/03/2014, 09:20
  • 7
  • 323
  • 0
Báo cáo Y học: Two GPX-like proteins from Lycopersicon esculentum and Helianthus annuus are antioxidant enzymes with phospholipid hydroperoxide glutathione peroxidase and thioredoxin peroxidase activities pptx

Báo cáo Y học: Two GPX-like proteins from Lycopersicon esculentum and Helianthus annuus are antioxidant enzymes with phospholipid hydroperoxide glutathione peroxidase and thioredoxin peroxidase activities pptx

... Two GPX-like proteins from Lycopersicon esculentum and Helianthus annuus are antioxidant enzymes with phospholipid hydroperoxide glutathione peroxidase and thioredoxin peroxidase activities Ste ´ phane ... study investigated the enzymatic function of two putative plant GPXs, GPXle1 from Lycopersicon esculentum and GPXha2 from Helianthus...
Ngày tải lên : 08/03/2014, 22:20
  • 7
  • 362
  • 0
Báo cáo Y học: Two independent, light-sensing two-component systems in a filamentous cyanobacterium pot

Báo cáo Y học: Two independent, light-sensing two-component systems in a filamentous cyanobacterium pot

... cphA:forward,GCGATA CCATGG TATCCGAATTCCAAG and reverse, ACCCGG GTCG ACTCAGTGATGGTGGTGATGGTGTCCTCGACC AAAAAGATC; rcpA:forward,GCGATA GAATTCATG AGCGTAGAAACGGAAGAC and reverse, CGAAGCTT GTCGACTCAGTGATGGTGGTGATGGTGCTCCG ACGGCAATGTCG; ... CGAAGCTT GTCGACTCAGTGATGGTGGTGATGGTGCTCCG ACGGCAATGTCG; cphB:forward,GCGATA GAATTC ATG ACGAATTGCGATCGCGA and reverse, ACCCGG GTCGACTCAGTGATGGTGGTGATGGTGTTTGAC CT...
Ngày tải lên : 08/03/2014, 23:20
  • 10
  • 499
  • 0
Báo cáo Y học: Two 1 : 1 binding modes for distamycin in the minor groove of d(GGCCAATTGG) docx

Báo cáo Y học: Two 1 : 1 binding modes for distamycin in the minor groove of d(GGCCAATTGG) docx

... prepared using BOBSCRIPT [34]. Ó FEBS 2002 Two 1 : 1 binding modes for distamycin (Eur. J. Biochem. 269) 2875 Two 1 : 1 binding modes for distamycin in the minor groove of d(GGCCAATTGG) Koen Uytterhoeven 1 , ... current crystal structures describe the interaction of distamycin in the minor groove of the central CAATTG sequen...
Ngày tải lên : 24/03/2014, 04:21
  • 10
  • 411
  • 0
Báo cáo Y học: Kinetic studies of human tyrosyl-DNA phosphodiesterase, an enzyme in the topoisomerase I DNA repair pathway pot

Báo cáo Y học: Kinetic studies of human tyrosyl-DNA phosphodiesterase, an enzyme in the topoisomerase I DNA repair pathway pot

... understand the enzymatic mechanism of this novel enzyme, and to facilitate inhibitor screening of human TDP, we have expressed and purified recombinant human TDP variants carrying deletions of 1–39 ... human TDP variants was approximated to be 5 mgặL )1 of E. coli culture (Fig. 2). TDP is involved in the Topo I DNA repair pathway, and inhibitors of TDP may have th...
Ngày tải lên : 31/03/2014, 21:21
  • 8
  • 503
  • 0
Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot

Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot

... syndrome and alter the course of established disease. These data suggest that autologous T cells primed and expanded with TGF-β have the potential to be used as a therapy for patients with systemic ... systemic lupus erythematosus and other chronic inflammatory diseases. This novel adoptive immunotherapy also has the potential to prevent the rejection of alloge...
Ngày tải lên : 09/08/2014, 03:24
  • 6
  • 408
  • 0
Báo cáo y học: "Polarized subsets of human T-helper cells induce distinct patterns of chemokine production by normal and systemic sclerosis dermal fibroblasts" doc

Báo cáo y học: "Polarized subsets of human T-helper cells induce distinct patterns of chemokine production by normal and systemic sclerosis dermal fibroblasts" doc

... by Th2 cells were affected strongly by both U-0126 and PSI and weakly by the JNK inhibitor (Fig- ure 6a,c). Finally, IP-10 mRNA levels induced by Th1 cells were decreased by U-0126 and PSI, and ... preferen- tially by Th1 cells and IL-8 mainly by Th2 cells, whereas MCP- 1 is induced equally by both subsets. This illustrates the capacity of fibroblasts to ac...
Ngày tải lên : 09/08/2014, 07:20
  • 12
  • 388
  • 0
Báo cáo y học: "Dominance of highly divergent feline leukemia virus A progeny variants in a cat with recurrent viremia and fatal lymphoma" pdf

Báo cáo y học: "Dominance of highly divergent feline leukemia virus A progeny variants in a cat with recurrent viremia and fatal lymphoma" pdf

... feline leukemia virus A progeny variants in a cat with recurrent viremia and fatal lymphoma. Retrovirology 2010 7:14. Submit your next manuscript to BioMed Central and take full advantage of: ã Convenient ... FeLV -A/ Glasgow-1 and env variant loads in all tissues. D) Viral (cDNA) env variant loads in tissues with and without apparent lymphoma. E) Tim...
Ngày tải lên : 12/08/2014, 23:23
  • 17
  • 314
  • 0
Báo cáo y học: " Journey to the heart of macrophages: the delicate relationship between HIV-1 and a multifaceted cell type" ppt

Báo cáo y học: " Journey to the heart of macrophages: the delicate relationship between HIV-1 and a multifaceted cell type" ppt

... this article as: Cimarelli: Journey to the heart of macrophages: the delicate relationship between HIV-1 and a multifaceted cell type. Retrovirology 2010 7:28. Submit your next manuscript to BioMed ... collectively named HIV encephalitis (HIVE) is described by the accompan ying review of Gras and Kaul [11]. Finally, the interplay between macrophage po...
Ngày tải lên : 12/08/2014, 23:23
  • 2
  • 287
  • 0
Báo cáo y học: "Two distinct variants of simian foamy virus in naturally infected mandrills (Mandrillus sphinx) and cross-species transmission to human" pptx

Báo cáo y học: "Two distinct variants of simian foamy virus in naturally infected mandrills (Mandrillus sphinx) and cross-species transmission to human" pptx

... www.biomedcentral.com/submit Mouinga-Ondémé et al. Retrovirology 2010, 7:105 http://www.retrovirology.com/content/7/1/105 Page 12 of 12 Two distinct variants of simian foamy virus in naturally infected mandrills (Mandrillus ... a monkey species living in central Africa, is naturally infected with SFV. We evaluated the natural history of the virus in a f...
Ngày tải lên : 13/08/2014, 01:20
  • 13
  • 357
  • 0
Báo cáo y học: " No association of xenotropic murine leukemia virus-related virus with prostate cancer or chronic fatigue syndrome in Japa" doc

Báo cáo y học: " No association of xenotropic murine leukemia virus-related virus with prostate cancer or chronic fatigue syndrome in Japa" doc

... Open Access No association of xenotropic murine leukemia virus- related virus with prostate cancer or chronic fatigue syndrome in Japan Rika A Furuta 1* , Takayuki Miyazawa 2 , Takeki Sugiyama 3 , ... W: Absence of evidence of Xenotropic Murine Leukemia Virus- related virus infection in persons with Chronic Fatigue Syndrome and healthy...
Ngày tải lên : 13/08/2014, 01:20
  • 12
  • 310
  • 0
Báo cáo y học: " Functional analysis of human T lymphotropic virus type 2 Tax proteins" pptx

Báo cáo y học: " Functional analysis of human T lymphotropic virus type 2 Tax proteins" pptx

... appeared to only reduce the activity of Tax 2B. However the introduction of an arginine instead of a cysteine at this position (Y1 44R) into Tax 2B abolished its activity indicating that this position is ... prevalence of mutations in Tax 2A pro- teins which inactivate both pathways may influence the pathogenic properties of certain HTLV-2A viruses. Table 4: Transactivation ph...
Ngày tải lên : 13/08/2014, 09:21
  • 10
  • 276
  • 0
Báo cáo y học: "Two discrete events, human T-cell leukemia virus type I Tax oncoprotein expression and a separate stress stimulus, are required for induction of apoptosis in T-cells" pptx

Báo cáo y học: "Two discrete events, human T-cell leukemia virus type I Tax oncoprotein expression and a separate stress stimulus, are required for induction of apoptosis in T-cells" pptx

... expression and a separate stress stimulus, are required for induction of apoptosis in T-cells Takefumi Kasai and Kuan-Teh Jeang* Address: Laboratory of Molecular Microbiology, NIAID, National Institutes ... c-Jun N-terminal kinase /stress- activated protein kinase pathway. A role for mixed lineage kinase 3/protein- tyrosine kinase 1, a novel member of the...
Ngày tải lên : 13/08/2014, 13:20
  • 12
  • 240
  • 0

Xem thêm

Từ khóa: