Báo cáo y học: "Partial pressure of end-tidal carbon dioxide successful predicts cardiopulmonary resuscitation in the field: a prospective observational study" potx
Báo cáo y học: "Partial pressure of end-tidal carbon dioxide successful predicts cardiopulmonary resuscitation in the field: a prospective observational study" potx
... out -of- hospital cardiac arrest. The patients wereintubated and measurements of end-tidal carbon dioxide taken.Data according to the Utstein criteria, demographic information,medical data, and partial pressure ... participated in designing the study, and collection and statistical analysis of data. PK participated in designing the study and helped todraft the manuscript. ŠG participated in designing the ... thereforeconfirmed the findings of studies that used animal models in which cardiopulmonary arrest was induced by asphyxia. In thisstudy the PetCO2 values during CPR were initially high, thendecreasing...
- 13
- 248
- 0
Báo cáo y học: "Partial pressure of end-tidal carbon dioxide predicts successful cardiopulmonary resuscitation in the field" docx
... conditions has a highfailure rate and disproportionate airway injury. The alternatives of a laryngeal mask airway or even a facial mask incorporating a mainstream carbon dioxide sensor may be utilized. ... ventricular tachycardia.As the authors pinpoint, PetCO2 has evolved into a technically facile and singularly useful monitor to guide cardiopulmonary resuscitation. PetCO2 provides an indirectmeasurement ... of end-tidal carbon dioxide successful predicts cardiopulmonary resuscitation in the field: a prospective observational study.Crit Care 2008, 12:R115.2. Falk J, Rackow EC, Weil MH: End-tidal carbon- dioxide...
- 2
- 217
- 0
Báo cáo Y học: Amphipathic property of free thiol group contributes to an increase in the catalytic efficiency of carboxypeptidase Y pot
... hydrophobicity and Gly, Ser, Asp andHis mutants to provide hydrophilicity. The catalytic roles of Cys341 in carboxypeptidase Y are examined by comparing the kinetic parameters of the Cys341 mutant enzymes.MATERIALS ... Hercules, CA,USA. Bistris was obtained from Nacalai Tesque, Kyoto,Japan. All other chemicals were of reagent grade andobtained locally.Strains and plasmid DNA The plasmid pTSY3 containing the PRC1 ... although it may not necessarilyhave any effect on the rate of acylation.Roles of Cys341 in the catalytic mechanism of carboxypeptidase Y Before the formation of the Michaelis complex, the freethiol...
- 6
- 459
- 0
Báo cáo y học: "Detailed analysis of 15q11-q14 sequence corrects errors and gaps in the public access sequence to fully reveal large segmental duplications at breakpoints for Prader-Willi, Angelman, and inv dup(15) syndromes" pdf
... GTCGGCTCCCAACTTCGT, and CTTTGGACACG-GCCTCC, respectively), S (ACGTGAGTTTGTTCAAGCAA-GTC, CTTCTTCCCAGCATGTCACAGAT, and CCGCCTC-CACAAGTT) and F (TGAAGTGTGGGTCATTTCCTAAGC,GGCAGACACAGCTGGGATAG, and CTACAGCCAT-GAGCTACTG).PCRs ... primers and annealing temperature (t) asfollows: B/Q (TGGAGCCAGTCCGAGATAGG, GCTTCAC-CACCACGACTGG, t = 63°C), M /A& apos; (CAAACTGTAATGT-GGCATCC, CAATGGTGCCTATCCCTGCC, t = 56°C), Z'/W(CTGATACATCACCAACTTGG, ... Z'/W(CTGATACATCACCAACTTGG, GAGACCAGCCTGAT-CAAGG, t = 62°C), and C/N (TGCTTGGGAATTTGATATGG,TGTGAATATTCCCATACAG, t = 56°C). PCR products wereresolved on 2% agarose gels.Additional data files The following...
- 16
- 383
- 0
Báo cáo y học: "Nonrandom divergence of gene expression following gene and genome duplications in the flowering plant Arabidopsis thaliana" doc
... the latter).Additional data files The following additional data are available with the onlineversion of this paper. Additional data file 1 is a description of dataset 1. Additional data file 2 is a description ... commu-nication, carbohydrate and lipid metabolism, and for geneswith hydrolase activity (Additional data file 3). Interestingly,genes of many of these classes are involved in reactionsagainst ... performed ananalysis of variance (ANOVA) and showed that 85% of the 280 paralogs exhibit a significant gene by organ interactioneffect, indicative of sub- and/or neofunctionalization. Ances-tral...
- 11
- 274
- 0
Báo cáo y học: "Urinary interleukin-18 does not predict acute kidney injury after adult cardiac surgery: a prospective observational cohort study" docx
... urinary IL-18 concentration andurinary IL-18/urinary creatinine ratio in relation to the postoperative development of acute kidney injury defined as anincrease in serum creatinine of greater ... possible that urinary IL-18 would be of greater value in patients at increased risk of developing AKI. In the absence of adjudication of aetiology, the sustained increase in serum creatinine may exclude, ... greaterthan 25% increase in creatinine, changes in creatinine to 72hours or 5 days, sustained increase of greater than 50%, sus-tained increase of greater than 25%, or AKI graded accordingto a variety...
- 8
- 304
- 0
Báo cáo y học: " Delayed neuropsychological sequelae after carbon monoxide poisoning: predictive risk factors in the " potx
... Personality changesDyspraxia AnxietyDysphasia Extreme emotional labilityAtaxia PsychosisPostural instability DepressionVertigo ManiaCortical blindness InsomniaHearing loss, tinnitusChoreaEEG ... patient. A Parkinson-li ke syndrome wi thsevere cognitive i mpairment and urinary incontinencedeveloped in another case (a 66 year s-old male present-ing coma and haemodynamic instability at admissio ... [Table 4]. The inclusion of categorical variable“HBO therapy” in the previous multivariate analysis con-firmed the lack of an association between DNS andHBO, confirming at the same time the...
- 8
- 238
- 0
Báo cáo Y học: Identification of novel membrane proteins by searching for patterns in hydropathy profiles potx
... was able to detect 100% of known GlyR andAChR across a range of species. The accuracy and sensitivity of the search strategy weretested by applying it to a custom database containingGABA A receptor ... Mostmembrane-associated domains produce an easily identifiedpeak in the hydropathy profile of the polypeptide. Standardsoftware tools are available that can identify the putativetransmembrane domains ... pattern of peaks in their hydropathy profiles. (A) The hydropathy profile of the human AChR alpha-1 subunit reveals a typical cluster of three peaks bracketed by deep valleys. The peak, baseand...
- 7
- 407
- 0
Báo cáo Y học: Proteolytic action of duodenase is required to induce DNA synthesis in pulmonary artery fibroblasts A role for phosphoinositide 3-kinase pot
... each of these pathwayshas a modulatory r ather than a mandatory role to play in mediating the proliferative response. In contrast, a recentreport has shown that tryptase induces DNA synthesis in canine ... trypsin cleaves and activatesPAR2. As duodenase is capable of cleaving certainsubstrates with trypsin-like primary specificity, we initiallyhypothesized that induction of DNA synthesis by duoden-ase ... proliferative p athwayand that each of the other pathways interacts with thispathway with the magnitude of the cellular responsedetermined by the integrated sum of each of thesecomponents. Our data...
- 10
- 437
- 0
Báo cáo y học: "Decreased levels of soluble amyloid β-protein precursor and β-amyloid protein in cerebrospinal fluid of patients with systemic lupus erythematosus" ppsx
... used as a detection antibody. The concentration of APP in samples of CSF was calculated from the linear part of a standard curve. In contrast to other analyses, only86 SLE patients were analyzed ... SLE and age-matchedcontrols were evaluated clinically, with magnetic resonanceimaging of the brain and CSF analyses. Levels of tau, amyloidprecursor protein (APP), β-amyloid protein (A 42), andtransforming ... mechanisms of neuropsychiatricmanifestations are still the subject of intense investiga-tions, but autoantibody and cytokine-mediated neural dys-function, intracranial angiopathy and coagulopathy...
- 8
- 342
- 0
Từ khóa: chuyên đề điện xoay chiều theo dạngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)