0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "Acute kidney injury in intensive care unit patients: a comparison between the RIFLE and the Acute Kidney Injury Network classifications" potx

Báo cáo y học:

Báo cáo y học: "Expression of ADAM15 in rheumatoid synovium: up-regulation by vascular endothelial growth factor and possible implications for angiogenesis" ppt

... correlate with synovial lining cellhyperplasia.A study by Bohm and co-workers [12] described the expres-sion of ADAM15 in RA and OA synovial tissues by immunohis-tochemistry and in situ hybridization, ... hematoxylin and eosin were analyzed by light microscopy according to our grading system of syno-vial lining cell hyperplasia, cellular infiltration and fibrosis [22]. For the experimental use of the ... 11Immunohistochemistry of ADAM15, vascular endothelial growth factor receptor (VEGFR)-2 and von Willebrand factor (vWF)Immunohistochemistry of ADAM15, vascular endothelial growth factor receptor (VEGFR)-2 and...
  • 16
  • 402
  • 0
Báo cáo y học:

Báo cáo y học: "Osteogenic protein 1 in synovial fluid from patients with rheumatoid arthritis or osteoarthritis: relationship with disease and levels of hyaluronan and antigenic keratan sulfate" ppt

... articleOsteogenic protein 1 in synovial fluid from patients with rheumatoid arthritis or osteoarthritis: relationship with disease and levels of hyaluronan and antigenic keratan sulfateSusan Chubinskaya 1, 2, ... osteogenic protein 1 (OP -1) in SF from patients with rheumatoid arthritis (RA) or with osteoarthritis(OA) and to correlate levels of OP -1 with those of hyaluronan (HA) and antigenic keratan sulfate ... protein 1 protein in synovial fluid samples. The osteogenic protein 1 (OP -1) content of synovial fluid from asympto-matic donors (donor) and from osteoarthritis (OA) and rheumatoid arthritis...
  • 10
  • 406
  • 0
Báo cáo y học:

Báo cáo y học: "Spectrocolorimetric assessment of cartilage plugs after autologous osteochondral grafting: correlations between color indices and histological findings in a rabbit model" ppt

... articleSpectrocolorimetric assessment of cartilage plugs after autologous osteochondral grafting: correlations between color indices and histological findings in a rabbit modelKoji Hattori1,2, Kota ... Kota Uematsu2, Yohei Tanikake2, Takashi Habata2, Yasuhito Tanaka2, Hiroshi Yajima2 and Yoshinori Takakura21Department of DAIWA HOUSE Indoor Environmental Medicine, Nara Medical University, ... vivo assessment. IntroductionAlthough articular cartilage shows durability and the ability tomaintain itself, it has limited capacity for repair [1,2]. The repair cartilage that forms as a result of articular injury has...
  • 9
  • 404
  • 0
Báo cáo y học:

Báo cáo y học: " Mild autonomic dysfunction in primary Sjögren''''s syndrome: a controlled study" pptx

... analysis.Analysis was performed by analysis of variance (ANOVA),multivariate ANOVA and repeated measures ANOVA, asindicated. Factor analysis was utilized to detect relationshipsbetween positive autonomic ... of mild, possibly subclinical autonomic dysfunction in pSS.Heart rate variability: time domain measuresThere was a relative tachycardia in pSS patients (Figure 2b) asassessed by repeated measures ... frequency range.Statistical analysisThe cardiovascular reflex test scores were analyzed as contin-uous variables rather than classified as normal, borderline andabnormal, as initially described...
  • 10
  • 922
  • 0
Báo cáo y học:

Báo cáo y học: "DREAM is reduced in synovial fibroblasts of patients with chronic arthritic pain: is it a suitable target for peripheral pain management" pptx

... 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3'siRNA4 5'-AAGCTCATGATGTTCTCATCCTATAGTGAGTCGTATTA-3' 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA-3'siRNA5 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' ... 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3'siRNA2 5'-AAGGTGAACTTGGTCTGGGCCTATAGTGAGTCGTATTA3' 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTATTA-3'siRNA3 5'-AAGTAGAGATTAAAGGCCCACTATAGTGAGTCGTATTA-3' 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3'siRNA4 ... 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' 5'-AAGTGAACAGATTGCTACACTATAGTGAGTCGTATTA-3'siRNA-GFP 5'-ATGAACTTCAGGGTCAGCTTGCTATAGTGAGTCGTATTA-3' 5'-CGGCAAGCTGACCCTGAAGTTCTATAGTGAGTCGTATTA-3'T7...
  • 8
  • 576
  • 0
Báo cáo y học:

Báo cáo y học: " Clinical review: Fever in intensive care unit patients" potx

... ofanimal models with fever and infection, call into question the routine practice of treating fever in critically ill patients.Keywords fever, heat shock proteins, intensive care unit, nuclear factor-κB, ... the intensive care unit (ICU) with severesepsis, the incidence of fever is more than 90% [2]. As thereis variation in the incidence of reported fevers, the etiology of fever in critically ill ... haveunderlying kidney or liver disease [9]. Additionally, there isevidence, at least in animal models, that fever is a benefi-cial host response to infection [10–12].Review Clinical review: Fever in...
  • 5
  • 427
  • 0
Báo cáo y học:

Báo cáo y học: "Quality of life before intensive care unit admission is a predictor of survival" pptx

... operating characteristic analysis of pre -admission HRQOL and APACHE II scores in relation to mortalityReceiver operating characteristic analysis of pre -admission HRQOL and APACHE II scores in relation ... advantages of using pre -admission HRQOL as a predictor of mortality are that it is easily obtained and available as soonas the patient, or a proxy (close family member), in the case of incapacity, ... GK, Hammermeister KE: Health-related quality of life as a predictor of mortality following coronary artery bypass graftsurgery. Participants of the Department of Veterans AffairsCooperative...
  • 7
  • 609
  • 0
Báo cáo y học:

Báo cáo y học: "Safety of rFVIIa in hemodynamically unstable polytrauma patients with traumatic brain injury: post hoc analysis of 30 patients from a prospective, randomized, placebo-controlled, double-blind clinical trial" pps

... http://ccforum.com/content/11/4/R85Page 1 of 8(page number not for citation purposes)Vol 11 No 4ResearchSafety of rFVIIa in hemodynamically unstable polytrauma patients with traumatic brain injury: post hoc analysis of 30 ... deduced from studies in hemodynamically stable patients with TBI. A dose-escalation study aimed primarily at assessing the safety of rFVIIa in TBI has recently been completed, and data analysis ... objective anatomicalfindings on CT imaging and also because the accuracy of theGCS assessment is limited in ventilated or pharmacologicallyparalyzed patients, such as those enrolled into this analysis. All...
  • 8
  • 292
  • 0
Báo cáo y học:

Báo cáo y học: "Evidence-based approach to intensive care unit management: need for improvement" potx

... ICU,and it is appropriate to develop training programmes wherethose capabilities are enhanced and trained.LetterEvidence-based approach to intensive care unit management: need for improvementAnders ... activities, with preparedness for policychanges and capacity for multiprofessional liaison betweenphysicians, nursing staff and personnel from other specialities.Typically, directors are recruited on ... critical care is rapidly developing into a professionwhere traditional boundaries between clinical specialities nolonger apply. Its management must be performed in closesynchrony to clinical...
  • 2
  • 330
  • 0
Báo cáo y học:

Báo cáo y học: "Mild therapeutic hypothermia shortens intensive care unit stay of survivors after out-of-hospital cardiac arrest compared to historical control" potx

... 1 of 8(page number not for citation purposes)Vol 12 No 3ResearchMild therapeutic hypothermia shortens intensive care unit stay of survivors after out -of- hospital cardiac arrest compared to ... intensive care unit (ICU) length of stay and ventilator time in patients after cardiac arrest were found to be either early death dur-ing ICU stay or rapid neurological recovery.ã Therapeutic hypothermia ... of the patient population and results of the univariate analysisFigure 1 Intensive care unit (ICU) length of stay and time on ventilator in the study groupsIntensive care unit (ICU) length of...
  • 8
  • 301
  • 0
Báo cáo y học:

Báo cáo y học: "Opioid-induced constipation in intensive care patients: relief in sigh" doc

... [4].CommentaryOpioid-induced constipation in intensive care patients: relief in sight?Daniel Chappell, Markus Rehm and Peter ConzenClinic of Anaesthesiology, Ludwig-Maximilians University, Nussbaumstrasse ... alterations in pharmacokinetics [8].Only about 4% of intensive care units currently haveguidelines for treating constipation [5]. Various laxativeinterventions exist at present; however, despite constipation often ... sepsis [2]. The aetiology ofbowel dysfunctions, in some cases progressing to a paralyticileus, is certainly complex, and major contributing factors onthe intensive care unit include parenteral...
  • 2
  • 166
  • 0
Báo cáo y học:

Báo cáo y học: "Acute kidney injury in intensive care unit patients: a comparison between the RIFLE and the Acute Kidney Injury Network classifications" potx

... http://ccforum.com/content/12/4/R110Page 1 of 8(page number not for citation purposes)Vol 12 No 4Research Acute kidney injury in intensive care unit patients: a comparison between the RIFLE and the Acute Kidney Injury Network ... WarnockDG, Levin A, Acute Kidney Injury Network: Acute Kidney Injury Network: report of an initiative to improve outcomes in acute kidney injury. Crit Care 2007, 11:R31.14. Manjunath G, Sarnak ... by the Risk, Injury, Failure, Loss of Kidney Function, End-stage Kidney Disease (RIFLE) and the Acute Kidney Injury Network (AKIN) definition/classification schemes RIFLE classification AKIN...
  • 8
  • 419
  • 0
Báo cáo y học:

Báo cáo y học: "Dexmedetomidine vs. haloperidol in delirious, agitated, intubated patients: a randomised open-label trial" pps

... extubation. In the primary analysis, patients whounderwent tracheostomy were analysed as having been extu-bated at that point (see discussion for rationale), but in a sup-plementary analysis ... into which a card indi-cating patient allocation had been placed according to a computer-generated random-number sequence. Dexmedeto-midine was administered intravenously as a maintenance infu-sion ... evidenceof efficacy, haloperidol, a centrally acting dopamine antagonistalso used in the treatment of major psychoses, is the drug rec-APACHE: Acute Physiology and Chronic Health Evaluation; CAM-ICU:...
  • 10
  • 223
  • 0
Báo cáo y học:

Báo cáo y học: "Correction: End-expiratory lung volume during mechanical ventilation: a comparison with reference values and the effect of positive end-expiratory pressure in intensive care unit patients with different lung conditions" pdf

... the original article. Reference 1. Bikker IG, van Bommel J, Reis Miranda D, Bakker J and GommersD: End-expiratory lung volume during mechanical ventilation: a comparison with reference values and the ... mechanical ventilation: a comparison with reference values and the effect of positive end-expiratory pressure in intensive care unit patients with different lung conditionsIdo G Bikker, Jasper ... had normal lungs, those in group P had a primary lung disorder, and those in group S had a secondary lung disorder. Values are expressed as mean ± standard deviation. EELV, end-expiratory lung...
  • 2
  • 213
  • 0
Báo cáo y học:

Báo cáo y học: " Respiratory support withdrawal in intensive care units: families, physicians and nurses views on two hypothetical clinical scenarios" pot

... Access Respiratory support withdrawal in intensive care units: families, physicians and nurses views on two hypothetical clinical scenariosRenata RL Fumis1*†, Daniel Deheinzelin2†AbstractIntroduction: ... limiting life -support therapy with terminally ill patients and favored family participation. In decisions concerning an incompetent patient, physicians were more likely tomaintain the therapy.IntroductionWhile ... between physicians and nurses opinion about discussing withdrawal of continued ventilationwith the family Physicians (%)N = 155 Nurses (%)N = 204Yes No Uncertain Yes No UncertainCompetent...
  • 8
  • 296
  • 0

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ