Báo cáo y học: " Measuring the time costs of exercise: a proposed measuring method and a pilot study" doc
Báo cáo y học: " Measuring the time costs of exercise: a proposed measuring method and a pilot study" doc
... maybe low and is rarely a motivator of the activity. Hence, the utility in use of the activity forgone in the investigationmay represent the marginal value of leisure time. The yardstick method ... investigation, performed the statistical analysis, and drafted and revised the manuscript. LAH and LL together developed the model and questionnaire, and planned and designed the study. LL made revi-sions ... first hour's work of the day is the most valuable, and may be necessary for survival, while the last hour of working is least valuable and may only increase the possi-bility of extended...
- 7
- 222
- 0
Báo cáo Y học: Monitoring the structural consequences of Phe12 fi D-Phe and Leu15 fi Aib substitution in human/rat corticotropin releasing hormone Implications for design of CRH antagonists pdf
... summary of statistical data indica-ting the quality of the 40 models and the average energy-minimized structure. The polypeptide chain of the human/rat CRH analogueseems to fold to an almost ... information towards the design and synthesis of new molecules with higherbinding affinity and enhanced stability against biologicaldegradation and possibly biological activity. The impact of Aib introduction ... [15] are alsodiscussed. The major goal of our study is the solution structuredetermination of a CRH analogue devoid of any agonistactivity, a fact particularly relevant to the further design and development...
- 11
- 515
- 0
Báo cáo Y học: Reconstructing the replication complex of AcMNPV pdf
... CATCACAGATCTATGATTGA GGCCCGGGGAATTCATGATTCAACATTTTAC GACAACATTTTAHEL 3¢ CCGCCCGGGTTAACATACA GGCCCGGGCTCGAGCATACAAATTTGGTACAC AAAATTTGGTACACDNApol 5¢ CATCACAGATCTATGAAAAT GGCCCGGGGAATTCATGAAATATCC AATATATCCDNApol ... GGCCCGGGCTCGAGTCGCCTCCCATTGTTAAT AACTCCCATTGTTAATIE2 5¢ CATCACAGATCTATGAGTCG GGCCCGGGAATTCAGTCGCCCAAATCAAC CAAATCAACIE2 3¢ CCGCCCGGGTTAACGTCTAG GGCCCGGGCTCGAGACGTCACATAACAG TAGACATAACAGP35 5¢ CATCACAGATCTATGTGTGT ... GGCCCGGGAGCTCTATGGCATGCATCG GAATGCATCGLEF-2 3¢ CCGCCCGGGAATTACAAAT GGCCCGGGCTCGAGTTACAAAGGATTG ATAGGATTGLEF-3 5¢ CATCACAGATCTATGGCGAC GGCCCGGGAATTCATGGCGCAAAAGATC ACCAAAAGATCLEF-3 3¢ CCGCCCGGGTTACAAAAATT GGCCCGGGCTCGAGAATTTATATATTC...
- 8
- 443
- 0
Báo cáo Y học: Optimizing the delivery systems of chimeric RNA . DNA oligonucleotides Beyond general oligonucleotide transfer ppt
... reproduciblesubstances, with a hydrocarbon core and charged surface of amino groups. They have the advantage of having a definedsmall size. However, their efficiency and toxicity still needevaluation.Nanoparticles ... (dioleoylphosphatidylethanolamine) has the ability to form nonbilayer phases and promote destabiliza-tion of the bilayer of the endosome membrane. DOPE isadded to cationic liposomes and other delivery systems ... nano-capsules such as poly(isobutyl-cyanoacrylate) (IBCA) arealso encapsulating nanoparticles. They can entrap oligonu-cleotides in their aqueous core [41].Fig. 3. RDO delivery systems and transfer...
- 6
- 425
- 0
Báo cáo y học: "Do the pleiotropic effects of statins in the vasculature predict a role in inflammatory diseases" pdf
... statins arecurrently available within the UK: pravastatin, simvastatin,fluvastatin, atorvastatin and rosuvastatin; in addition,lovastatin is available in other countries. Cerivastatin hasbeen ... inmiddle-aged male patients with a moderate degree of hyperlipidaemia but no prior personal history of cardiovascular disease. The value of statin therapy inpatients with known coronary artery disease and ... 96:1398-1402.51. Kobashigawa JA, Katznelson S, Laks H, Johnson JA, Yeatman L,Wang XM, Chia D, Terasaki PI, Sabad A, Cogert GA, et al.: Effect of pravastatin on outcomes after cardiac transplantation. NEngl...
- 7
- 334
- 0
Báo cáo y học: "Defining the chromatin signature of inducible genes in T cells" pps
... H3K9ac and H3 antibodies and Affymetrixmouse promoter arrays (1.0R) and the data were analyzedusing the model-based analysis of tiling array (MAT) algo-rithm [30]. The promoter region of a gene ... human data set contains information about a number of other acetylation marks and we found that the majority of the acetylation marks showed a similar pattern to H3K9ac, withH2AK9ac, H2BK20ac, ... by real -time PCR analysis. The data are presented as the ratio of immunoprecipitated DNA to the total input DNA and show Pol II occupancy at the promoter (green bars) and 2 kb downstream of the...
- 18
- 641
- 0
Báo cáo y học: " Unraveling the genomic diversity of small eukaryotes" potx
... the plant family Brassicaceae, while a third has made a host jump across plant families and is a parasite of members of the family Resedaceae. The sequences of metagenomes - the total DNA of ... and Inaki Ruiz-Trillo (University of Barcelona, Spain) highlighted studies on the evolutionary significance of the Choano flagellata, the Nuclearia and the Blastocladiomycota that support the ... more than 17,500 genes and is very rich in gene and segmental duplications. The origin of the Metazoa is a landmark event in the history of life and we are now taking critical steps in the under-standing...
- 3
- 279
- 0
Báo cáo y học: "Elucidating the molecular characteristics of organogenesis in human embryos" potx
... experi-mental models but humans are the targets of potential diagnostic and therapeutic approaches. Although humans and mice share 85% of their genes and undergo a similar process of embryogenesis, ... of this work is that it will enable direct comparisons of available mammalian transcrip-tomes. is type of comparative analysis is highly rele-vant, considering that mice are one of the main ... Carnegie stage 9 to stage 14. A complementary study using a strategy similar to that of Fang et al. has analyzed the transcriptome of human embryos from Carnegie stage 10 to stage 23, which,...
- 3
- 456
- 0
Báo cáo y học: "Investigating the complementary value of discrete choice experiments for the evaluation of barriers and facilitators in implementation research: a questionnaire survey" pptx
... DCE and the traditional ques-tions that might challenge the comparability of the results. First, DCE is based on random utility theory thatassumes that an individual acts rationally and alwayschooses ... careprofessionals when they think of breast cancer surgery inday care. Also, the cooperation of the ward nursing staff and management was considered highly important.Cooperation of patients and patient ... potential barriers and facilitators were included in the DCE asdecision attributes. Data were gathered among anaesthesiologists, surgical oncologists, and breastcare nurses by means of a paper -and- pencil...
- 12
- 398
- 1
Báo cáo y học: "Can the collective intentions of individual professionals within healthcare teams predict the team''''s performance: developing methods and theory" docx
... the uptake of research findings, and hence to reduce inappropriate care – using theory-basedapproaches to understanding the behaviours of healthcareprofessionals and the quality of care that ... northeast England, and primary care doc- tors, nurses, and practice assistants in the Netherlands. Weregarded all the healthcare workers within a practice as a team. Data on roles and cognitions ... participantsThis was a predictive study of the theory-based cognitions and clinical behaviours concerning the management of patients with diabetes of a sample of primary care doctors and nurses from northeast...
- 10
- 386
- 0
Từ khóa: Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam