0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "Involvement of a small GTP binding protein in HIV-1 release" ppsx

Báo cáo y học:

Báo cáo y học: "Involvement of a small GTP binding protein in HIV-1 release" ppsx

... [Fig. 3A] . This was observedeither by modifying the polymerising actin itself, by CytoD action, or by inhibiting one key GTP binding protein involved in a molecular pathway that leads to actin ... purposes)Engagement of small GTP binding proteins in HIV-1 releaseFigure 3Engagement of small GTP binding proteins in HIV-1 release. Jurkat HIV-1 infected cells were incubated for 20 h with various ... postulated that the actin polymerisation pathway itselfmay play a crucial role in efficient HIV-1 release.ResultsInhibition of small GTP- binding proteins abolishes HIV buddingWe have tested...
  • 9
  • 286
  • 0
Báo cáo y học:

Báo cáo y học: "Effect of a small molecule inhibitor of nuclear factor-κB nuclear translocation in a murine model of arthritis and cultured human synovial cells" pps

... (RA) is a chronic inflammatory diseasethat affects nearly 1% of the population worldwide and canlead to significantly impaired quality of life. Mortality rates arealso significantly increased ... activities of optically active dehydroxymethylepoxy-quinomicin, a novel NF-κB inhibitor. Tetrahedron 2004,60:7061-7066.23. Nanki T, Nagasaka K, Hayashida K, Saita Y, Miyasaka N: Chemok-ines regulate ... inhibitory effect. Transplantation 2003,76:1380-1382.39. Takatsuna H, Asagiri M, Kubota T, Oka K, Osada T, Sugiyama C,Saito H, Aoki K, Ohya K, Takayanagi H, Umezawa K: Inhibition of RANKL-induced...
  • 12
  • 459
  • 0
Báo cáo y học:

Báo cáo y học: " Involvement of HTLV-I Tax and CREB in aneuploidy: a bioinformatics approach" pot

... H, Tanaka Y, Tamada M, Hu CD,Yamawaki-Kataoka Y, Kariya K, Kataoka T: Association of yeastadenylyl cyclase with cyclase-associated protein CAP forms a second Ras -binding site which mediates ... the activity of the cyclic AMP (cAMP) pathway andphysically interacts with the adenylyl cyclase Cyr1p/Cdc35p, where a Gα subunit-type protein called Gpa2pand the GTP binding Ras proteins both ... Kinoshita K, Amagasaki T, Ikeda S, Suzuyama J, Toriya K, Nishino K,Tagawa M, Ichimaru M, Kamihira S, Yamada Y, et al.: Preleukemicstate of adult T cell leukemia: abnormal T lymphocytosisinduced...
  • 21
  • 531
  • 0
Báo cáo Y học: Stabilization of a (ba)8-barrel protein by an engineered disulfide bridge potx

Báo cáo Y học: Stabilization of a (ba)8-barrel protein by an engineered disulfide bridge potx

... bonds asprobes of the folding pathway of barnase: i ncreasing the stability of proteins against the rate of denaturation. Biochemistry 32,4322–4329.16. Sambrook, J., Fritsch, E.E. & Maniatis, ... in the parental protein. Keywords: indoleglycerol phosphate synthase; (b /a) 8-barrelproteins; stabilizing disulfide bonds; protein e ngineering.Indoleglycerol phosphate synthase (IGPS) is a ... cysteine is almost completelyprotected. In contrast, at least two cysteines of red(3–189) reactrapidly. As the positions of T3 and R189 of eIGPS arepartially accessible to solvent (ASA values...
  • 9
  • 465
  • 0
Báo cáo y học:

Báo cáo y học: "Development of a synoptic MRI report for primary rectal cancer" ppsx

... community and tertiarycare hospitals in Ontario, Canada will be asked to nomi-nate practicing clinicians that provide care to rectal cancerpatients and have demonstrated clinical leadershipthrough ... on a small number of physicians torefine wording and flow of questions.Qualitative research methods and data analysisStandard principles of qualitative research will be used tosample the participants ... will be tabulated to compare physi-cian opinions and enablers and barriers of implementa-tion of clinical synoptic reports by physician, as well ascontextual factors. Finally, theoretical constructs...
  • 6
  • 440
  • 0
Báo cáo y học:

Báo cáo y học: " Isolation of a new HIV-2 group in the US" pptx

... be accurately diagnosed. A falsely negative PCRresult may lead clinicians to infer that an individual'sinfection is latent or that the antibody tests are false posi-tives.These data demonstrate ... epidemiology in Senegal: changes in HIV diversity. AIDS Res Hum Retroviruses2007, 23:1189-1196.2. Loeff MF van der, Awasana AA, Sarge-Njie R, Sande M van der, Jaye A, Sabally S, et al.: Sixteen years ... con-taining HIV-1 and HIV-2 antigens. The western blot for HIV-1 was negative. His HIV-1 viral load was <48 copiesand polymerase chain reaction (PCR) for HIV-1 proviralDNA was negative. An...
  • 3
  • 250
  • 0
Báo cáo y học:

Báo cáo y học: "Effectiveness of a Chinese herbal medicine preparation in the treatment of cough in uncomplicated upper respiratory tract infection: a randomised double-blinded placebo-control trial" docx

... disease(include asthma or chronic obstructive arirway disease) orcardiac disease (including valvular heart disease), hadconcurrent gastrointestinal symptoms such as nausea,vomiting, abdominal pain or diarrhoea) ... treatment.Outcome measures and data analysisTreatment period lasted for 5 days. During which, clinicalassessments including history, examination and tests (ifnecessary) were performed at day ... a day.RandomisationRandomisation and allocation was taken place onpatients' first visit at the Staff Clinic. Informed consentwas obtained according to the local laws and the GoodClinical...
  • 9
  • 451
  • 0
Báo cáo y học:

Báo cáo y học: "Causes of a high physiological dead space in critically ill patients" ppt

... space accordingly (above that normallypresent due to the volume of air in the conducting airways).They also show that the increase in pCO2can be avoided byeven modest increases in total alveolar ... 60% of the cardiac output.Fourth, V• A /Q•inequality is generally a cause of greaterphysiological dead space than shunt is (Figure 1) (calcula-CommentaryCauses of a high physiological dead ... pCO2, thereby increasingdead space, and how changes in other variables such as cardiacoutput and acid/base state further modify it. A solid understanding of respiratory physiology is required...
  • 2
  • 211
  • 0
Báo cáo y học:

Báo cáo y học: "Dissection of a metastatic gene expression signature into distinct components" ppsx

... that, in tumor cells, loss -of- function plays a moredominant role in acquiring a metastatic phenotype than gain of function. Future analyses may indicate whether any of thetumor cell metastasis ... that lead to greater predictive accuracy and an increase in the types of samplesthat can be included are presented.BackgroundDNA microarray technology has advanced our understanding of cancer ... 2001,20:6196-6204.19. Yamabuki T, Daigo Y, Kato T, Hayama S, Tsunoda T, Miyamoto M, ItoT, Fujita M, Hosokawa M, Kondo S, Nakamura Y: Genome-widegene expression profile analysis of esophageal squamous cellcarcinomas....
  • 12
  • 198
  • 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1888 CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 ... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT 1300 CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT 1232CLAP_1:TTGCTTGGGGGGAAGACTCGTTACAATTCTTTTTCTTTATTTTCTTTTTAGGTAGCTTCTTTATTTTATTTTTTT -A TCTCTTTCTTGATTTTCTTTTCT...
  • 12
  • 772
  • 0

Xem thêm

Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI