Báo cáo y học: "Highly specific inhibition of leukaemia virus membrane fusion by interaction of peptide antagonists with a conserved region of the coiled coil of envelope" potx

... purposes)RetrovirologyOpen AccessResearchHighly specific inhibition of leukaemia virus membrane fusion by interaction of peptide antagonists with a conserved region of the coiled coil of envelopeDaniel Lamb1, ... and coiled coil, which will facilitate comparative analysis of leukaemia virus TM function and may provide information of value in the development of improved,therapeutically relevant, antagonists ... within the groove of the coiled coil. It appears that the LHR-derived peptide Pcr-400 makes similar contacts with the coiled coil and that these contacts are necessary for stablebinding of...

Báo cáo y học: "Correction: Extravascular lung water index measurement in critically ill children does not correlate with a chest x-ray score of pulmonary edem" doc

... Table 2. Patient characteristics per patient Probability Probability of death of death Patient Age Weight Length of PICU Ventilator PRISM II PIM number Gender (months) (kg) Diagnosis stay ... Diagnosis stay (days) days % % Outcome 1 F 24 14.0 Near Drowning 19 17 85 60 survived 2 F 83 18.0 Reconstruction of pulmonary artery 18 16 7 6 survived 3 F 23 14.0 Abdominal surgery 5 3 78 17 ... Meningococcal disease 6 5 22 19 survived 6 F 2 4.8 Arterial switch operation 13 10 39 3 survived 7 F 5 7.1 Tetrology of Fallot repair 16 14 18 3 survived 8 F 8 6.5 Reconstruction of pulmonary artery...

Báo cáo y học: "Two specific drugs, BMS-345541 and purvalanol A induce apoptosis of HTLV-1 infected cells through inhibition of the NF-kappaB and cell cycle pathways" ppsx

... Watanabe M, Ohsugi T, Shoda M, Ishida T, Aizawa S, Maruyama-NagaiM, Utsunomiya A, Koga S, Yamada Y, Kamihira S, Okayama A, KikuchiH, Uozumi K, Yamaguchi K, Higashihara M, Umezawa K, Watanabe ... Dewan MZ, Terashima K, Taruishi M, Hasegawa H, Ito M, Tanaka Y, Mori N, Sata T, Koyanagi Y, Maeda M, Kubuki Y, Okayama A, Fujii M,Yamamoto N: Rapid tumor formation of human T-cell leuke-mia virus ... 10:693-695.25. Mori N, Yamada Y, Ikeda S, Yamasaki Y, Tsukasaki K, Tanaka Y, Tomonaga M, Yamamoto N, Fujii M: Bay 11-7082 inhibits tran-scription factor NF-kappaB and induces apoptosis of HTLV-I-infected...

Báo cáo y học: "Highly efficient genetic transduction of primary human synoviocytes with concentrated retroviral supernatant" pdf

... Centrifu-gation of retroviral supernatant is a potentially attractiveapproach to viral concentration because of the wide avail-ability of centrifuge equipment, the simplicity of the tech-Available ... developed a flow cytometry assay to rapidly measure the titer of infectious viral particles (Fig. 1). This assaytakes advantage of the fluorescent properties of the EGFPtransgene. A total of 2 × ... supernatant was aspi-rated and saved for analysis. The viral pellet was resus-pended in fresh medium by gentle pipetting.Quantitation of viral RNA by slot blot hybridizationViral RNA was quantitated...

Báo cáo y học: "Tissue-specific spatial organization of genomes" docx

... (Figure 4a) . A close pair was defined as two chromo-somes separated by less than 20% of nuclear diameter andresults were statistically analyzed by contingency table analy-sis [10]. In hepatocytes, ... Ramos C, da Silva MG, Parreira A, Parreira L: The nucleartopography of ABL, BCR, PML, and RARalpha genes: evi-dence for gene proximity in specific phases of the cell cycleand stages of hematopoietic ... expectation value of contingency tables is dependent on the number of analyzed cells. For analysis of 5-6 pairing, 83 hepatocytes and 118 lymphocytes were analyzed. For analysis of 12-15 pairing,...

Báo cáo y học: "Homoeolog-specific retention and use in allotetraploid Arabidopsis suecica depends on parent of origin and network partners" doc

... GGTAGG AGAAGGGTCAAA GAGGAT AACGGA TGAGTAT GCGCGGTCT GCTATAGATTGGGGA A G T T A .T T A G A A .T G A G A G C. .A G T T A .T T A. G A A T G A . A G T T A .T T A G A T G A A T T A .T T A G.G A. GA T ... arrays to compare gene expressionbetween At, Aa, and F1As. More than 15% of transcriptsAT1G65450.1GGTTTTAACCGCATACGCAAAGGAGAAATG CAAGGC ATTGCTTGAAGA GCCGTT TGGGAGGATTGT AGAAAT GGTAGG AGAAGGGTCAAA ... genome-wide Arabidopsis tilingmicroarray, we scanned the genomes of At, Aa, As,andF1As.WeanalyzedthetranscriptomeofAs with tilingarrays and validated results with Illumina resequencing.We assembled...

Báo cáo y học: " Allele-specific copy number analysis of tumor samples with aneuploidy and tumor heterogeneity" ppt

... gratitude to Ms. Karolina Edlund for expert assistance in DNA isolation and analysis as well as Mrs. Maria Rydåker at the Uppsala Array Platform for the SNP array analysis. Mrs. Lena Lenhammar ... an allele frequency cut-off. TAPS is available from the authors [16]. All aberrations in a single sample are visualized by plotting the Allelic Imbalance Ratio against the average Log-ratio ... tumor samples, partially validated through SKY karyotyping and DNA ploidy analysis. Allelic i mbalance oLog-RatioAlleleencyLog-RatioAllelefrequencyAveragelog-ratioHomozygousHeterozygousHomdHomdcn8m4cn7m3cn6m3cn6m2cn5m2cn4m2cn6m1cn5m1cn4m1cn3m1cn2m1cn4m0cn3m0cn2m0cn1m0AllelicimbalanceratioAverage...

Báo cáo y học: "Gender-specific effects of HIV protease inhibitors on body mass in mice" ppt

... [35].StatisticsData were analyzed by two-way analysis of variance(ANOVA), one-way ANOVA, and the Student Newman-Keuls T-test was used for post-hoc comparisons, whereappropriate. Significance was ... induced by HIV protease inhibitorsin an environment of elevated cholesterol.Background The use of highly active anti-retroviral therapy (HAART)has dramatically increased the lifespan of individualsinfected ... (Moun-tain View, CA). The intra-assay variance and inter-assayvariances were 2.8% and 2.6%, respectively. 17β-estradiolwas measured with a kit from Research Diagnostic Inc(Concord, MA). The intra-assay...

Báo cáo y học: "Anti-oxidant inhibition of hyaluronan fragment-induced inflammatory gene expression" pps

... stimulated with HAfragments and NAC for 18 h; cell supernatants were har-vested and analyzed for specific chemokine and cytokineexpression by ELISA. As was the case for macrophages,NAC markedly ... to phagocyticcells as we demonstrate a similar inhibition of HA frag-ment induced IP-10 in a human airway epithelial cells.Mechanistically the anti-oxidants NAC and DMSO inhibit the HA fragment ... injury and inflammation via induction of cytokines, chemokines and modulatory enzymes.Hyaluronan (HA), a negatively charged normally highmolecular weight glycosaminoglycan, is ubiquitously dis-tributed...

Báo cáo y học: " Highly variable pharmacokinetics of dexmedetomidine during intensive care: a case report" docx

... its plasma clearance and the rate of infusion.Accordingly, the calculated clearance of dexmedetomi-dine was increased by 60%. The reason for the increasedclearance can only be speculated.Dexmedetomidine ... of dexmedetomidine, the change to another alpha2-adreno-ceptor agonist was probably unnecessary.Our patient developed optic neuropathy probablybecause of cerebral ischemia secondary to hypotension,hypoxia ... speculated.Dexmedetomidine is almost completely eliminated by metabolism in the liver. It is mainly N-glucuronidated by glucuronyl transferases and hydroxylated by severalcytochrome P450 enzymes [5], but none of the...

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Thơ nôm tứ tuyệt trào phúng hồ xuân hương Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM