Báo cáo y học: "Impaired nuclear import and viral incorporation of Vpr derived from a HIV long-term non-progressor" docx
Báo cáo y học: "Impaired nuclear import and viral incorporation of Vpr derived from a HIV long-term non-progressor" docx
... non-progressorLeon Caly1, Nitin K Saksena2, Sabine C Piller3,4 and David A Jans*1Address: 1Department of Biochemistry and Molecular Biology, Monash University, Clayton, Victoria 3800, Australia, 2Retroviral ... levels significantly reduced comparedto wildtype (Fig. 1B). Sequence analysis revealed that allclones with reduced nuclear accumulation (Vpr A6 -2 and Vpr A6 -3/5) contained a phenylalanine to leucine ... defense against viral attack. Nat Immunol 2004, 5:1109-1115.48. Wang B, Dyer WB, Zaunders JJ, Mikhail M, Sullivan JS, Williams L,Haddad DN, Harris G, Holt JA, Cooper DA, Miranda-Saksena M, Boa-dle...
- 7
- 268
- 0
Báo cáo y học: "Lifetime health effects and medical costs of integrated stroke services - a non-randomized controlled cluster-trial based life table approach"
... is substantial (about half a QALY), especiallyas compared to the total number of QALYs usuallylived after a stroke (on average 2.42 for men and 3.33for women in usual care). The estimated lifetime ... events separately. Finally,patients can leave the model because of any other, (iv)non-related cause of death. All death, incidence and recurrences rates are stroke severity specific and basedeither ... dis-ability after stroke, and the four probabilities of death -affect patients’ courses in the same way as they did in theoriginal life-table model [5]. The annual probability of a vascular...
- 10
- 568
- 0
Báo cáo y học: " Magnetic resonance imaging and mammographic appearance of dermatofibrosarcoma protuberans in a male breast: a case report and literature review" doc
... Dermatofibrosarcoma protuberans is a rare soft tissue sarcoma and its occurrenceon the breast is even rarer. Mammography and magnetic resonance imaging can help in characterizingthe lesion and ... Bai1 and Xian Zhao1Addresses:1Department of Radiology, Second Hospital of Medical College of Xi’an Jiaotong University Xi’an, Shaanxi, China,2Department of Radiology, Good Samaritan Hospital, ... sites of involvement. We report a rare case of malebreast with dermatofibrosarcoma protuberans and its imaging features. To our knowledge theimaging appearance of dermatofibrosarcoma protuberans...
- 4
- 411
- 0
Báo cáo y học: "HLA-DR regulation and the influence of GM-CSF on transcription, surface expression and shedding
... study [22]. Sample preparation and flow cytometry Arterial blood was collected from septic patients on the day sepsis was diagnosed (day 0) and on days 3, 7, and 14 for PCR studies and days ... Star). Forward HLA-DR Primer: ATCATGACAAAGCGCTCCAACTAT Reverse HLA-DR Primer: GATGCCCACCAGACCCACAG (Sigma, UK) Soluble HLA-DR measurement by ELISA Ninety six well ELISA plates (Nunc, Denmark) were ... –70ºC and assayed for sHLA-DR as described earlier. Western Blotting for sHLA-DR in cell lysates and plasma Cell lysates of protein were prepared from PBMC of septic patients and healthy volunteers....
- 11
- 618
- 0
Báo cáo Y học: Synthesis, conformational analysis and biological activity of cyclic analogs of the octadecaneuropeptide ODN Design of a potent endozepine antagonist pot
... become a standard strategy in medicinal chemistryfor increasing the receptor affinity and selectivity of peptideligands [13,14,27]. The Ala-scan of OP has revealed thatthe side chain of each residue ... structure determination (fileparallhdg.pro and topallhdg.pro) was used, and an initialstructure was built by randomly generating F and C angles.In the calculations starting from random structure, ... investigated the biological activity of these analogs by measuring their ability to modifycytosolic calcium concentrations and polyphosphoinositideturnover in cultured rat astrocytes.MATERIALS AND...
- 13
- 632
- 0
Báo cáo Y học: Azidothymidine causes functional and structural destruction of mitochondria, glutathione deficiency and HIV-1 promoter sensitization pptx
... from nonacetylated chloramphenicol by ascending thin-layerchromatography [18]. Chromatograms were examined and quantified with a Fuji image analyzer BA100. HIV- 1-LTR DNA binding assay HIV- 1-LTR DNA ... & Ames, B.N. (1987) Normal oxidativedamage to mitochondrial and nuclear DNA is extensive. Proc.Natl Acad. Sci. USA 85, 6465–6467.25. Hayakawa, M., Ogawa, T., Sugiyama, S., Tanaka, M. & ... Medical Research Institute, Tokyo Medical and Dental University, Tokyo, Japan;2Ikawa Laboratory, RIKEN, The Institute of Physical and Chemical Research, Wako, Saitama, JapanMitochondrial functional...
- 7
- 378
- 0
Báo cáo Y học: Changes in ultrastructure and the occurrence of permeability transition in mitochondria during rat liver regeneration ppt
... GDH and AAT activity in mitochondria and cytosols isolatedat 24 h after PH and the enzyme activities in mitochondria and cyto-sols isolated from control rats or at 96 h after PH are statisticallysignificant ... release from mitochondria during reoxygenation of rat liver. Transplantation 57, 144–148.35. Takahasi, H. & Yamaguchi, M. (1996) Enhancement of plasmamembrane (Ca2+-Mg2+)–ATPase activity ... the cytosolic AAT was stable, therewas a thermal instability of mitochondrial AAT at 70 °C[22]. The activity of mitochondrial AAT was taken as thedifference between the two values.Determination...
- 9
- 494
- 0
Báo cáo y học: "On demand treatment and home therapy of hereditary angioedema in Germany - the Frankfurt experience" pptx
... current state -of- the-art review, VII: Canadian Hungarian2007 International Consensus Algorithm for the Diagnosis, Therapy, and Managment of Hereditary Angioedema. Ann Allergy Asthma Immunol2008, ... 10:118-133.doi:10.1186/1710-1492-6-21Cite this article as: Aygören-Pürsün et al.: On demand treatment and home therapy of hereditary angioedema in Germany - the Frankfurtexperience. Allergy, Asthma & Clinical Immunology 2010 6:21.Submit ... burden of the disease while offering a maximum quality of life to our patients.IntroductionOn demand treatment of acute angioedema in HAE type I and IIHereditary angioedema (HAE) is based on a...
- 4
- 520
- 0
Báo cáo y học: "Improved cartilage integration and interfacial strength after enzymatic treatment in a cartilage transplantation model" potx
... investigate whethertreatment of articular cartilage with hyaluronidase and collagenase enhances histological and mechanical integration of a cartilage graft into a defect. Discs of 3 mm diameter ... thesetechniques are generally not directly aimed at local integra-tion with the surrounding healthy cartilage. Variable and suboptimal wound healing and integration may be a cause of potential failure of ... composition and biome-chanical properties. Specifically, we applied a combinationhyaluronidase and collagenase treatment on both sides of a cartilage explant, and tested the effect of this treatmenton...
- 8
- 477
- 0
Báo cáo y học: "E3 ubiquitin ligases and their control of T cell autoreactivity" potx
... ligases GRAIL, Cbl-b, Itch, and NEDD4 ubiquitinate and chaperone critical proximalsignaling molecules into an endocytic pathway and directthem away from the immunological synapse and into a lyso-somal ... activation of CD25–T cellsthrough an activation of a TGFβ receptor-Smad2 pathway[55]. The activation of Smurf1 E3 ligase activity leads to a ubiquitination and degradation of both Smad proteins and TGFβ ... Vav, and p85, perhaps sequestering them within an endocytic pathway.Additionally, PLCγ and PKCθ appear to be ubiquitinated and degraded within an endosomal/lysosomal compartment during activation.Ub,...
- 10
- 392
- 0
Từ khóa: báo cáo khoa học y họcbáo cáo y họcbáo cáo y học cổ truyềnbáo cáo y tế học đườngmẫu báo cáo y tế học đườngBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015