Báo cáo y học: " APOBEC3G encapsidation into HIV-1 virions: which RNA is it?" pptx
Báo cáo y học: " Laugh Yourself into a Healthier Person: A Cross Cultural Analysis of the Effects of Varying Levels of Laughter on Health"
... All rights reserved Research Paper Laugh Yourself into a Healthier Person: A Cross Cultural Analysis of the Effects of Varying Levels of Laughter on Health Hunaid Hasan, Tasneem Fatema ... indicate the name of the condition regardless of a “yes”, the survey was discarded assuming the participant did not fully un-derstand the question. Statistical analysis The data was analyzed ... influence their laughter. Neurophysioanatomy of Laughter The neuro-anatomical pathway for laughter has finally been understood after twenty years of re-search. A single centre located in the dorsal...
- 12
- 757
- 0
Báo cáo y học: "New insights into integrin signalling: implications for rheumatoid arthritis synovial fibroblasts" pptx
... transfer to synoviocytes andosteoclasts. J Clin Invest 1999, 104:137-146.14. Pap T, Franz JK, Hummel KM, Jeisy E, Gay RE, Gay S: Activationof synovial fibroblasts in rheumatoid arthritis: lack ... cultured rheumatoid synoviocytes. JRheumatol 1995, 22:817-828.12. Morel JC, Park CC, Zhu K, Kumar P, Ruth JH, Koch AE: Signaltransduction pathways involved in rheumatoid arthritis syn-ovial ... invasion of articular cartilage by rheumatoid synovial fibroblasts is inhibited by antibodies to specific inte-grin receptors and by collagenase inhibitors. Arthritis Rheum1997, 40:1298-1307.10....
- 2
- 251
- 0
Báo cáo y học: "Structural insights into the function of the core-circadian factor TIMING OF CAB2 EXPRESSION 1 (TOC1)" ppt
... (AB189040), OsPRR95(AB1890 41 ), OsPRR59 (ABA 915 59), CsTOC1(AY 611 028), LjTOC1 (AP0049 31) , McTOC1(AY3 712 88), PtTOC1 (NW_0 014 927 41) , and VvTOC1(CAO64 513 )For phylogenetic confirmation of ... purposes)Journal of Circadian RhythmsOpen AccessResearchStructural insights into the function of the core-circadian factor TIMING OF CAB2 EXPRESSION 1 (TOC1)Elsebeth Kolmos, Heiko Schoof, Michael ... and the Arabidopsis Bio-logical Clock. Plant Cell 2007, 19 : 211 1- 212 3. 15 . Alabadi D, Oyama T, Yanovsky MJ, Harmon FG, Mas P, Kay SA:Reciprocal regulation between TOC1 and LHY/CCA1 withinthe...
- 12
- 592
- 0
Báo cáo y học: "Thread embedded into penile tissue over time as an unusual hair thread tourniquet injury to the penis: a case report" doc
... tissue damage was minimal. Over the years, as the patient's penis grew, the intact tour-niquet was gradually incorporated into the substance of the penis.This case is peculiar and is the first ... 9-year-old boy presented with a 3-year history of hair thread tourniquet injury to his penis. Instead of the usual strangulation or amputation, the tourniquet had become embedded into the penile ... CentralPage 1 of 3(page number not for citation purposes)Journal of Medical Case ReportsOpen Access Case report Thread embedded into penile tissue over time as an unusual hair thread tourniquet...
- 3
- 228
- 0
Báo cáo y học: " Human immunodeficiency virus type 1 Vpr: oligomerization is an essential feature for its incorporation into virus particles" ppsx
... interactions between human immunodeficiency virus type 1 Vpr and p6(Gag). J Virol 20 01, 75 :10 537 -10 542. 16 . Poon B, Chen IS: Human immunodeficiency virus type 1 (HIV -1) Vpr enhances expression from ... events and enhances fas-induced apoptosis in human T cells. J Virol 2009, 83 :11 283 -11 297.doi: 10 .11 86 /17 43-422X-7 -11 9Cite this article as: Venkatachari et al., Human immunodeficiency virus type ... Cohen EA: Human immunodeficiency virus type 1 Vpr is a positive regulator of viral transcription and infectivity in primary human macrophages. J Exp Med 19 98, 18 7 :11 03 -11 11. 5. Lum JJ, Cohen...
- 11
- 257
- 0
Báo cáo y học: "New insights into the pathogenesis of glucocorticoid-induced avascular necrosis: microarray analysis of gene expression in a rat model" potx
... reproduction in any medium, provided the original work is properly cited.Research articleNew insights into the pathogenesis of glucocorticoid-induced avascular necrosis: microarray analysis of gene expression ... subcutane-ously into 24 Wistar Kyoto rats (12 males and 12 femalesrats) at the age of five weeks. Each pellet was implantedbeneath the skin on the lateral side of the neck by surgi-cally making an incision ... thanother endothelial cells in the body. In keeping with the theory of endothelial cell activation having a role in ANFH, coagulation-related gene expression in particularserine (or cysteine)...
- 12
- 312
- 0
Báo cáo y học: "Variability science in intensive care – how relevant is it" docx
... variability in intensive care. The commentary discusses whyvariability can nevertheless accurately estimate prognosis and how easily this can be implemented in the critically ill.Keywords heart ... a marker of sympathetic activity in conditions ofCommentaryVariability science in intensive care – how relevant is it?P van de BorneDepartment of Cardiology, Erasme Hospital, Brussels, BelgiumCorrespondence: ... Research by Seely et al., see page 513AbstractThe article by Seely et al. in this issue of Critical Care highlights that variability portend prognosis.Numerous parameters interact to modify variability...
- 2
- 258
- 0
Báo cáo y học: " APOBEC3G encapsidation into HIV-1 virions: which RNA is it?" pptx
... 1Mechanism of APOBEC3G encapsidation. Four differ-ent scenarios can be envisioned: (1) APOBEC3G is packaged non-specifically. This possibility seems unlikely given the known affinity of APOBEC3G ... RNA; in particular 7SL RNA was proposed to mediate encapsidation of APOBEC3G. (4) APOBEC3G is packaged through specific interaction with viral genomic RNA. This model is our favorite and is ... TG, Ly H, Strebel K: Viral RNA is required for theassociation of APOBEC3G with human immunodeficiencyvirus type 1 nucleoprotein complexes. J Virol 2005,79:5870-5874.Mechanism of APOBEC3G encapsidationFigure...
- 2
- 200
- 0
Báo cáo y học: " APOBEC3G-UBA2 fusion as a potential strategy for stable expression of APOBEC3G and inhibition of HIV-1 replication" pot
... 5' primer used was 5'-ATCCAAGACGGAATTCACGCCGCAGGAGAAA-GAAGCTATAG-3'; the 3' primer for the APOPEC3G-UBA2 fusion was 5'-ATCGTACTCGAAGCTTCTAACTCAGGAG-GAAGTTGGCAG-3'; ... AccessResearch APOBEC3G- UBA2 fusion as a potential strategy for stable expression of APOBEC3G and inhibition of HIV-1 replicationLin Li1,4, Dong Liang1, Jing-yun Li4 and Richard Y Zhao*1,2,3,4Address: ... protein band because it only reacts to certain batches of anti -APOBEC3G antibody. To elimi-nate this background, the protein intensity of APOBEC3G- UBA2 and APOBEC3G- UBA2* was calculated by subtracting...
- 13
- 254
- 0
Báo cáo y học: "APOBEC3G induces a hypermutation gradient: purifying selection at multiple steps during HIV-1 replication results in levels of G-to-A mutations that are high in DNA, intermediate in cellular viral RNA, and low in virion RNA" pps
... in levels of G-to -A mutations that are high in DNA, intermediate in cellular viral RNA, and low in virion RNARebecca A Russell1, Michael D Moore2, Wei-Shau Hu2 and Vinay K Pathak*1Address: ... respectively. These results indicated that purifying selection pressure was operating againstgenomes that had inactivating mutations in the gag gene.The observation that a few of the viral RNA-derivedsequences ... C-terminal portion of Vif was amplified using the for-ward primer YRHHYmutF, 5'GGAAAGCTAAGGACTGGTTTGCTGCAGCTGCCGCTGAAAGTACTAATCCAAAAATAAG3', and the reverse primer VifR, 5'GGATAAACAGCAGTTGTTGC3'....
- 15
- 320
- 0
Báo cáo y học: "APOBEC3G levels predict rates of progression to AIDS" ppsx
... mRNA levels may serveas a predictor of the rate of disease progression, it will notbe a mere surrogate of CD4+ T cell count.Testing the hypothesis To test whether hA3G mRNA expression levels ... 2Departments of Microbiology and Immunology, University of Rochester, Rochester, New York 14642, USA, 3Department of Biostatistics and Computational Biology, University of Rochester, Rochester, New York ... thateach known factor only plays some degree of protection,and unknown protective host factors may yet to be discov-ered.APOBEC3G (apolipoprotein B mRNA-editing enzyme,catalytic polypeptide-like...
- 7
- 92
- 0
Báo cáo y học: " APOBEC3G targets human T-cell leukemia virus type 1" docx
... activity of APOBEC3G on human T-cell leukemia virus type 1 (HTLV-1), the first identified human retrovirus.Results: In this study, we have demonstrated that overexpressed as well as endogenous APOBEC3G ... enzyme-catalytic polypeptide-like 3G (APOBEC3G) is a host cellular protein with a broad antiviral activity. It inhibits infectivitiy of a widevariety of retroviruses by deaminating deoxycytidine ... purposes)RetrovirologyOpen AccessResearch APOBEC3G targets human T-cell leukemia virus type 1Amane Sasada1, Akifumi Takaori-Kondo*1, Kotaro Shirakawa1, Masayuki Kobayashi1, Aierkin Abudu1,...
- 10
- 212
- 0
Báo cáo y học: "APOBEC3G & HTLV-1: Inhibition without deamination" docx
... inhuman hepatocytes – the primary target for HBV – is verylow.Against this backdrop appeared a study by the Uchiyamalaboratory investigating the potential antiviral activity ofAPO3G towards ... Interestingly, the geneticdiversity of HTLV-1 is much lower than that of HIV-1 eventhough both viruses target primarily APO3G-expressing Inhibition of virus infectivity by APO3GFigure 1 Inhibition ... viral cDNA can be tar-geted by uracil-DNA glycosylase, which could lead to endonucleolytic cleavage by endonucleases present in the target cell (3). Alternatively, hypermutated cDNA enters the...
- 3
- 110
- 0
Báo cáo y học: "Preliminary study into the components of the fear-avoidance model of LBP: change after an initial chiropractic visit and influence on outcome." pps
... Prelimi nary study into the components of the fear-avoidance model of LBP: change after an initial chiropractic visit and influence on outcome. Chiropractic & Osteopathy 2010 18:21.Submit your ... Osteopathy 2010, 18:21http://www.chiroandosteo.com/content/18/1/21Page 9 of 9 RESEARC H Open AccessPreliminary study into the components of the fear-avoidance model of LBP: change after an initial ... about theirproblem and for them to be examined by someone whois perceived as interested and concerned may directlyease some of the affective aspects of worry and anxietysuch as fear-beliefs and...
- 9
- 381
- 0
Báo cáo y học: " Non-operative management of blunt abdominal trauma. Is it safe and feasible in a district general hospital?" doc
... Trauma, Resuscitation and Emergency MedicineOpen AccessOriginal research Non-operative management of blunt abdominal trauma. Is it safe and feasible in a district general hospital?George A ... eval-uated according to Injury Severity Score (ISS) and organinjury according to Injury Scaling and Scoring System [9].Patients' status in admission was evaluated by ISS, admis-sion hematocrit, ... Panayotis A Patsaouras - patsaourasp@yahoo.com; Michalis K Digalakis - cdigalaki@yahoo.gr* Corresponding author †Equal contributorsAbstractBackground: To evaluate the feasibility and safety of non-operative...
- 6
- 435
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật