Báo cáo y học: "Nef-mediated enhancement of cellular activation and human immunodeficiency virus type 1 replication in primary T cells" docx
Báo cáo y học: "Nef-mediated enhancement of cellular activation and human immunodeficiency virus type 1 replication in primary T cells" docx
... examine the ability of Nef to associate with SH3domain-containing cellular factors that i nfluence bothPAK2 association and T cell activation. This interactionis an attractive potential therapeutic ... therapeutic target because aninhibitor that blocks the ability of Nef to interact withhost cell f actors important for enhancement of H IV -1 replication and T cell activation would be expected toreduce ... enhancement of cellular activation and human immunodeficiency virus type 1 replication in primary T cells is dependent onassociation with p 21- activated kinase 2Kevin C Olivieri 1 , Joya Mukerji 1 and...
- 17
- 239
- 0
Báo cáo y học: " Coordinate enhancement of transgene transcription and translation in a lentiviral vector" pps
... primers(5'TTTTTATCGATAAGCTCAATATTGGCCATATTATTCATTGG3' and 5'TTTTCATATGCAGTTGTTACGACATTTTGGAAAG3') and ligated with NdeI-ClaI-digested PCE-Luc and U3-Luc in order to create IE-PCE-Luc and IE-U3-Luc, ... found that binding of histone deacetylase enzymeHDAC1 to the LTR of an HIV -1 provirus induced altera-tions in the chromatin structure that disrupted binding of RNA polymerase II and silenced transcription. ... manuscript submitted]. PCE is not strictlyposition-dependent and sustains activity when reposi-tioned to at least 300 nt downstream of the transcriptionstart site [17 ]. In addition, PCE facilitates...
- 10
- 325
- 0
Báo cáo y học: "The influence of serum, glucose and oxygen on intervertebral disc cell growth in vitro: implications for degenerative disc disease" potx
... ↔Cell death ↔↔↔↔Collagen synthesis ↑↑↑ Type I ↓ Type II ↔ Type I ↔ Type II ↔ Type I ↔ Type II ↓↓↓ Type I ↓ Type IISerum GlucoseAlginate With Without With WithoutCell proliferation ↓↓ ↓↓↓ ... deprivation, but not serum or oxygen deprivation,inhibited synthesis of type I and type II collagen, both in monolayer and alginate cultures.Conclusion This study demonstrates that factors present ... ↔↑↑↔↔Cell death ↔↓↓↔↔Collagen synthesis ↓ Type I ↑↑ Type II ↔ Type I ↔ Type II ↔ Type I ↔ Type II ↔ Type I ↓↓ Type II↑, increased; ↓, decreased; ↔, no change (from control conditions).Arthritis Research...
- 8
- 324
- 0
Báo cáo y học: "RNA interference of argininosuccinate synthetase restores sensitivity to recombinant arginine deiminase (rADI) in resistant cancer cells" pps
... cell lines deficient in argininosuccinate synthetase aresensitive to arginine deprivation by arginine deiminase. Int J Cancer2008, 12 3 :19 50 -19 55.doi :10 .11 86 /14 23- 012 7 -18 -25Cite this article ... 18 :25http://www.jbiomedsci.com/content /18 /1/ 25Page 10 of 11 MCF-7 cells in the presence of rADI treatment. The cellcycle patterns of EGFP-transduced MCF-7 cells with and without rADI treatment were also similar to that of thecontrols ... Sensitivity of cancer cells to recombinant arginine deiminase (rADI) depends on expression of argininosuccinate synthetase (AS), a rate-limiting enzyme in synthesis of arginine from citrulline. To...
- 11
- 313
- 0
Báo cáo sinh học: " Streamlined design of a self-inactivating feline immunodeficiency virus vector for transducing ex vivo dendritic cells and T lymphocytes" ppsx
... se minimally dependent on this motifTransduction of primary murine DCs and T lymphocytes with LAW34/VSV-G and LAW34/RD 114 /TRFigure 7Transduction of primary murine DCs and T lym-phocytes with ... (LAW34/RD 114 /TR; Fig.6A) was titrated for TU in the same cell substrate using theultracentrifugation and the PB/DT protocols. Again, in spite of a three-fold increment of the vector RNA titer aftersupernatant ... efficiently transduce DCs withFIV vectors [14 -16 ,40] may have been due to the use of Envs that did not permit proper entry into these cells. Of note, in agreement with findings showing that DCs trans-duced...
- 13
- 277
- 0
Báo cáo y học: "Systematic profiling of cellular phenotypes with spotted cell microarrays reveals mating-pheromone response genes" pot
... asregulatory functions (the histone deacetylase SDS3 and theubiquitin protein ligase UBR2 ). We separately validated theBNI1 and UBR2 involvement by reconstructing and retestingthe deletion strains. ... clearly differentiated from the normally shmooing strains in this assay (Figure 3), except for those deleted for five inhib-itors of the pathway that arrest growth strongly in this assay(that is, ... arrest(growth rate / growth rate )untreated +alpha factor0.5 1. 0 1. 5 2.0 2.5 3.0Number of yeaststrainsNumber of yeaststrainsNumber of yeaststrains030 10 002468 10 12 Number of yeaststrains0 10 202468 12 SDVPS8...
- 9
- 273
- 0
Báo cáo y học: "A Comparison of Immuncapture Agglutination and ELISA Methods in Serological Diagnosis of Brucellosis"
... an effect on the sensitivity, specificity and ultimately applicability of the method (12 ,14 ). ELISA tests are relatively costlier tests in comparison to agglutination tests that require ... tests. Ig M and G type antibodies that form against this structure are identi-fied through agglutination tests. ELISA test which is among these tests and makes it possible to determine the type ... evaluated together, sensitivity and specificity were found to be 94 .1 % and 97 .1 % re-spectively. Evaluation of two Ig’s together rather than one by one increases their sensitivity and specificity...
- 5
- 604
- 0
Báo cáo y học: "The association of meat intake and the risk of type 2 diabetes may be modified by body weight"
... data on associations between total meat and type of meat intake and the risk of type 2 DM are inconsistent and limited [3]. Total meat intake was associated with a higher risk of diabetes in ... independent of this Western dietary pattern [5;6]. Our study offers a unique opportunity to investigate associations between meat intake and the risk of type 2 DM with little confounding from a Western ... dietary pattern protective against type 2 diabetes in the European Prospective Investigation into Cancer and Nutrition (EPIC) Potsdam Study cohort. Diabetologia 2005; 48(6) :11 26 -11 34. 18 ....
- 8
- 701
- 0
Báo cáo y học: "Comparative study of serum Na+ and K+ levels in senile cataract patients and normal individuals"
... Department of Biochemistry and Nutrition in Iran University of Medical Sciences. He is interested in study of nutrition and trace elements in human blood. Manuchehr Imamian obtained BSc in Chemistry ... Journal of Clinical Nutrition. 19 96; 63: 985-990. 17 . Claytone RM, Culthbert J, et al. Some risk factor associated with cataract in Scotland. A pilot study. Trans Ophthalmology Society, 19 82; 10 2: ... constituents correlate with human cataract. British Journal of Ophthalmology 19 95; 79: 10 36 -10 41. 26. Luntz MH. Clinical types of cataract. In: Tasman W, Jeager A, eds. Duane’s Clinical Ophthalmology....
- 5
- 611
- 1
Tài liệu Báo cáo Y học: The structures of the lipooligosaccharide and capsule polysaccharide of Campylobacter jejuni genome sequenced strain NCTC 11168 pdf
... amplified with:glfF10 81 (5¢-TTTTACAAAATAATAATGCCGATCT-3¢) and glfR6 (5¢-TGATTATTTAATTGTTGGTTCTGGA-3¢). The PCR products were ligated to pPCR-ScriptAmp according to the manufacturer’s instructions. ... strain C. jejuni NCTC 11 168. The outer coreLOS of NCTC 11 168 has structural homology with the human gangliosides, GM2 and GM1a. As demonstratedpreviously in NCTC 11 168 [16 ,17 ,48] and in 81 17 6 ... mixture of GM1a and GM2 core types with the GM2 core type mimicpredominating.Comparison of LOS core structures of NCTC 11 168(HS:2) with the HS:2 serostrain indicated that both theterminal...
- 18
- 718
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ