Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot
Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot
... 34kDa, V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR gcgctttattgacattttggat VIRvsLTNP CD8 2.0 2.8BAG3 NM_004281.3 BCL2 -associated athanogene 3 BAG3L cagccagataaacagtgtggac BAG3R agaggcagctggagactgg ... -2.4ACTA2 NM_001613.1 actin, alpha 2, smooth muscle, aorta ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt BDLvsVIR CD8 -1.3 -2.2ATP6V1D NM_015994.2 ATPase, H+ transporting, lysosomal ... proteasome subunit, beta type, 2 PSMB2L agagggcagtggaactcctt PSMB2R gaaggttggcagattcagga VIRvsLTNP CD8 1.3 2.3PSMA5 NM_002790.2 proteasome subunit, alpha type, 5 PSMA5L tgaatgcaacaaacattgagc...
- 21
- 376
- 0
Báo cáo y học: "Antibodies against PM/Scl-75 and PM/Scl-100 are independent markers for different subsets of systemic sclerosis patients" doc
... or the clinical characteristics of the patients.Statistical analysis The dataset was analyzed by means of the SPSS version 15.0statistical package (SPSS Inc., Chicago, IL, USA) and the cal-culation ... studyincluded 113 patients with lSSc, 96 patients with dSSc, 51patients with an overlap syndrome, 16 patients with UCTD, and 4 patients with SScSS. The clinical and epidemiologicaldata of this ... demonstrate for the first time that the reactivityto PM/Scl depends on the underlying disease and furthermoreon the clinical symptoms. Interestingly, the majority of patientsshowed reactivity to...
- 9
- 473
- 0
Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx
... broad range of bacterial species. Thepolysaccharides often constitute the outermost layer of the cell, and have been implicated as an important factor in thevirulence of many animal and plant ... in A. actinomycetemcomitans SUNYaB 75 (serotype a) con-tains 14 ORFs (Fig. 2A) . A protein database search wasperformed with the programsFASTA[37] and BLASTat theNational Institute of Genetics, ... by PCR using chromosomal DNA of E. coliDH 5a as a template with the following primers:5¢-CGCGCATATGTCAAAAGTCGCTCTCATC-3¢ (NdeI) and 5¢-ATATCCCGGGTGACTCCAGCGCGATCGC-3¢(SmaI). After purification...
- 9
- 625
- 0
Báo cáo y học: "Reduction in antioxidant enzyme expression and sustained inflammation enhance tissue damage in the subacute phase of spinal cord contusive injury" ppt
... proinflammatory factor, TNF -a and IL-1b (T/ I) at the doses of 20 ng/ml. The total proteins were extracted, separated bySDS-PAGE, and analyzed by western blotting with anti-b-actin, anti-GFAP.Wang ... follows:anti-b-actin, anti-actin regulatory protein (CAPG) and anti-cathepsin D (CATD) antibodies (Santa CruzBiotechnology, Santa Cruz, CA); anti-GFAP and anti-GAPDH antibodies (Chemicon, Temecula, CA);anti-superoxide ... was then added toterminate the react ion. The apoptotic cells (TdT-FragEL+cells) were visualized by incubating tissues with DAB, and counted per section.Preparation of primary astrocytes and...
- 16
- 429
- 0
Báo cáo y học: "Gene polymorphisms in APOE, NOS3, and LIPC genes may be risk factors for cardiac adverse events after primary CABG" pdf
... of the CETPvariant, and hetero- or homozygosity for the prothrombinG2021 0A variant. Patients had to be homozygous for PAI-1 5G insertion.Statistics For statistical data analysis Microsoft® ... med-ical therapy of risk factors have become the basis for sec-ondary CAD prevention after primary coronary arterybypass grafting (CABG). Appearance of cardiac adverseevents after primary CABG ... risk factors at the time of primary CABG hadlimited impact on the occurrence of cardiac adverse events.Arterial Hypertension was evident at the time of primary surgery in 73% of our patients and...
- 8
- 404
- 0
Báo cáo y học: "An artificial intelligence tool to predict fluid requirement in the intensive care unit: a proof-of-concept study" docx
... treat-ments are given simultaneously to a patient in the ICU and interact with each other. The nature of these interactions islikely to vary from patient to patient, and perhaps even withinthe ... physiological datafrom the previous 24 hours.Materials and methodsThe Laboratory of Computational Physiology at Massachu-setts Institute of Technology developed and maintains theMulti-parameter Intelligent ... and format-ted to facilitate data-mining. The three sources of data arewaveform data collected from the bedside monitors, hospitalinformation systems and other third-party clinical informationsystems.Using...
- 7
- 291
- 0
báo cáo hóa học: " Cyclooxygenase-2 mediates microglial activation and secondary dopaminergic cell death in the mouse MPTP model of Parkinson''''s disease" pptx
... are aug-mented by the behavioral analysis. We thoroughlyassessed motor movement using an automated locomotoractivity test and Rotarod apparatus. For the total distance and vertical activity ... workexamined microglial activation at early stages followingMPTP administration; thus, it is possible that examina-tion of pathology at later stages is a better indicator of microglial activation. ... became stable and was more consistent withineach experimental group. Our present study demonstratesthat MPTP significantly reduces total distance traveled and vertical activity of the mice, and...
- 16
- 468
- 0
Báo cáo khoa học: "Within crown variation in hydraulic architecture in beech (Fagus sylvatica L): evidence for a stomatal control of xylem embolism" docx
... natural conditions.Concomitent variations in leaf water potential and stomatal conductance were studied in relation with vul-nerability to cavitation.2. MATERIALS AND METHODS2.1. Plant MaterialFive ... vulnerability tocavitation in Fagus sylvatica can acclimate to contrasting ambient light conditions, and we conclued that stomatal response to waterstress occured early and sufficiently fast to protect ... weremade in the trunkto increase the resistance towater transfert.We followed thechanges in leaf andxylem water potential andstomatal conductance after the cuts at three levels within the canopy....
- 10
- 329
- 0
Báo cáo y học: "Gender differences in suicidal expressions and their determinants among young people in Cambodia, a post-conflict country" doc
... study, carried out the data-collection and analysis, and drafted the manuscript. GK participated in the design of thestudy, performed the statistical analysis, contributed to the results section,interpretation ... study through the school admin-istration and the parent association, respectively. Weinformed the students that participation was entirelyvoluntary and that they could opt-out at any time dur-ing ... section,interpretation of the data, and gave feedback on the manuscript. Both theauthors have read and approved the final manuscript.Competing interestsThe authors declare that they have no competing...
- 8
- 411
- 0
Báo cáo y học: "SIV antigen immunization induces transient antigen-specific T cell responses and selectively activates viral replication in draining lymph nodes in retroviral suppressed rhesus macaques" pptx
... TTGCAGCACCCACAACCA-3’Reverse: 5’-TGATCCTGACGGCTCCCTAA-3’Probe: 5’- CTCCACAACAAGGACA-3’IFN-g Forward: 5’- GTGTGGAGACCATCAAGGAAGAC-3’Reverse: 5’- CGACAGTTCAGCCATCACTTGGAT-3’Probe: 5’-ACTGACTCGAATGTCCAACGCAAAGC-3’GAPDH ... experiments were performed in strict accor-dance with the standards of the Association for Assess-ment and Accreditation of Laboratory Animal C areInternational and the “ GuidefortheCareandUseofLaboratory ... Andrew A Lackner3 and Drew Weissman1*AbstractBackground: HIV infection causes a qualitative and quantitative loss of CD4+ T cell immunity. The institution of anti-retroviral therapy (ART) restores...
- 11
- 287
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenidentification of subpopulations of cd4 and cd8 t cells that differ in functioncd4 and cd8 t cells in tumors of immunized micebáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ