Báo cáo y học: "Identification of an endogenous retroviral envelope gene with fusogenic activity and placenta-specific expression in the rabbit: a new "syncytin" in a third order of mammals" ppt

... fortherapeutic intervention in pulmonary hypertension. Pharmacol Ther2001, 92:1-20.3. Rabinovitch M: Pulmonary vascular remodeling in hypoxic pulmonary hypertension. In Hypoxic Pulmonary Vasoconstriction ... involvement of bone marrow cells in pulmonary hypertension and vascular remodeling. Although Young et al. reported thatinhibition of CXCR4 activity by AMD3100 decreased hypoxia-induced pulmonary hypertension ... [26]recently used a neonatal mouse model of pulmonary hypertension and found that the inhibition of CXCR4 activity significantly decreased hypoxia-induced pulmon-ary hypertension. Interestingly, Gambaryan...

... placenta (right) and haematoxylin and eosin staining of a day 12 placenta section (left) with the 3 main layers of the placenta indicatedFigure 6Structure and in situ hybridization for syncytin-Ory1 ... syncytin-Ory1 expression of day 12 rabbit placenta: (A) Schematic repre-sentation of a rabbit placenta (right) and haematoxylin and eosin staining of a day 12 placenta section (left) with the 3 main layers ... RT-PCR assays for their in vivo tran-scriptional activity in a large panel of tissues including the placenta, cloning of the candidate genes, ex vivo assays fortheir fusogenicity and, ultimately,...

... c-myc tag wasinserted into the pcDNA3.1(+)/Zeo HuPAR2 backbone bysite-directed mutagenesis with the following primer pair:5'-CCAGCTTTGGGCTGAATGGAACAAAAACTTATTTCT-GAAGAA GATCTGATGGCAGCACCCACG ... populations were assayed for PERV -A binding and infection by a FACS-based PERV -A SU IgG binding assay and a PERV pol qPCR-based infection assay. PERV pol copy numbers were normal-ized to wild-type ... relationships of HuPAR1 and HuPAR2are not only important to further a general understanding of gammaretroviral cell entry, but also, central to advanc-ing a science-based risk-assessment for a...

... cord injury and other inflammatory or destructiveconditions of the CNS[24,25].We investigated the cross packaging ability of the Gag-Polcomponents of HIV-1, HIV-2 and SIV and found a unique non -reciprocal ... 60% of glial cell expressing GFP with 20 ng of input vector and approximately 58% with 10 ng of vector. In summary, the gene transfer efficiency of the HIV-2 GFP vector to be cross packaged by SIV ... HIV-1 and HIV-2 homologous vector systems.Transduction of human embryonic neuronal stem cellswas also performed using the HIV-1 and HIV-2 homolo-gous vector system (not shown) and with the SIV...

... embryo by means of the immunosuppressive domain [52].Two seemingly intact env genes not detected in the recentsurvey of intact human envelope genes [41] are equallyinteresting in terms of possible ... [2]. Finally, screening the human genome in silico does not guarantee detection of polymorphic HERV loci in which the empty pre-integra-tion site is still segregating in the human population.Indeed, ... However,none of them are completely intact. In fact, 41 of the above 59 long vORFs, are all betaretroviral and stem from the HERV-K group. Interestingly, 15 of the remaining 18non-betaretroviral...