Báo cáo y học: " Identification of a high incidence region for retroviral vector integration near exon 1 of the LMO2 locus" pot
Báo cáo y học: " Identification of a high incidence region for retroviral vector integration near exon 1 of the LMO2 locus" pot
... locusKoichiro Yamada 1 , Tomonori Tsukahara 1 , Kazuhisa Yoshino 1 , Katsuhiko Kojima 1 , Hideyuki Agawa 1 , Yuki Yamashita 1 , Yuji Amano 1 , Mariko Hatta 1 , Yasunori Matsuzaki 1 , Naoki Kurotori 1 , ... http://www.retrovirology.com/content/6 /1/ 79Page 9 of 9(page number not for citation purposes) 11 . Tsukahara T, Agawa H, Matsumoto S, Matsuda M, Ueno S, Yamashita Y, Yamada K, Tanaka N, Kojima K, Takeshita T: ... improve the safety of gene therapy.In conclusion, the identification of the HIR near exon 1 of the LMO2 locus in the T cell lines and human CD34+ cellsmay partially explain the mechanism responsible...
- 9
- 302
- 0
Báo cáo y học: "APOBEC3G induces a hypermutation gradient: purifying selection at multiple steps during HIV-1 replication results in levels of G-to-A mutations that are high in DNA, intermediate in cellular viral RNA, and low in virion RNA" pps
... C-terminal portion of Vif was amplified using the for- ward primer YRHHYmutF, 5'GGAAAGCTAAGGACTGGTTTGCTGCAGCTGCCGCTGAAAGTACTAATCCAAAAATAAG3', and the reverse primer VifR, 5'GGATAAACAGCAGTTGTTGC3'. ... 5'CAGGGAGATTCTAAAAG3', and the reverse primer YRHHYmutR, 5'CTTATTTTTGGATTAGTACTTTCAGCGGCAGCTGCAGCAAACCAGTCCTTAGCTTTCC3', were used to amplify the N-terminal region of Vif. The ... inhibit A3 G and thus grow in the non-per-missive cells, 10 00 RT unit aliquots of the HIV-YRHHY > A5 viruses from the days of peak RT for samples YA (day 13 ), YB (day 11 ), and YC (day 13 ) were added...
- 15
- 320
- 0
Báo cáo hóa học: "Research Article A Geometrical-Based Model for Cochannel Interference Analysis and Capacity Estimation of CDMA Cellular Systems" pot
... havevalidated the accuracy of the model. In many cases, the results derived from the hexagonal model and the inradiuscircular approach were similar. The dependence of the capacity of a WCDMA ... of the probability of interference also.In order to validate the accuracy and reliability of the models, simulation results are presented. The pdfs in (1) and (17 )areevaluatedforatestcaseofasingleclustersizeWCDMA ... validate the accuracy of the proposed model. Applications in the capacity estimation of WCDMA cellular networks are presented. Dependence of system capacity of the sectorization of the cells and...
- 7
- 298
- 0
Báo cáo hóa học: " Research Article A New Approximation Method for Solving Variational Inequalities and Fixed Points of Nonexpansive Mappings" docx
... of successive approximations for nonexpansivemappings,” Bulletin of the American Mathematical Society, vol. 73, pp. 5 91 597, 19 67.7 R. T. Rockafellar, “On the maximality of sums of nonlinear ... nonlinear monotone operators,” Transactions of the American Mathematical Society, vol. 14 9, pp. 46–55, 2000.8 H. K. Xu, “Iterative algorithms for nonlinear operators,” Journal of the London Mathematical ... nonexpansive mappings in Hilbert spaces,”Journal of Mathematical Analysis and Applications, vol. 318 , no. 1, pp. 43–52, 2006.4 H. Iiduka and W. Takahashi, “Strong convergence theorems for nonexpansive...
- 16
- 268
- 0
Báo cáo y học: "Soluble RAGE: a hot new biomarker for the hot joint" pdf
... arthritissynovial membrane. J Rheumatol 19 99, 26:2523-2528. 10 . Yan SF, Ramasamy R, Naka Y, Schmidt AM: Glycation, inflam-mation and RAGE: a scaffold for the macrovascular complica-tions of diabetes ... such as the following: Do plasma sRAGE levels vary from day to day in a subject? Do they vary over the lifespan of the individual?What were the levels of sRAGE in the RA subjects before the onset ... mechanisms. At least fourclasses of inflammatory ligands, namely S100/calgranulins,amphoterin (also known as high mobility group box I orHMGB1), Mac -1, and advanced glycation endproducts(AGEs), are...
- 3
- 368
- 0
Báo cáo y học: " Is Ankyrin a genetic risk factor for psychiatric phenotypes?" pot
... 19 99, 323 :15 1 -15 5.Gella et al. BMC Psychiatry 2 011 , 11 :10 3http://www.biomedcentral.com /14 71- 244X /11 /10 3Page 4 of 541and42withdiseaseatadistanceof84.5kbtors980 419 0 [10 ].Ankyrin 3 is a brain expressed ... atrecruitment of 42.5 years and 220 cases (13 4 males, 61% ) with unipolar depression (F32-F33). with an aver-age age at onset of 43 years and an average age atrecruitment of 51 years.Sample was further ... unipolar depression (table 1 and 2).Gella et al. BMC Psychiatry 2 011 , 11 :10 3http://www.biomedcentral.com /14 71- 244X /11 /10 3Page 2 of 5RESEARC H ARTIC LE Open AccessIs Ankyrin a genetic risk factor...
- 5
- 422
- 0
Báo cáo y học: " Respiratory Research: a new multidisciplinary journal for a new age " doc
... primary articles. The fulltext of all primary research articles will, therefore, bewidely available online free of charge, ensuring that allresearch findings are easily accessible to the respira-tory ... Jeffery Drazen of Harvard University, who was the North American Editor-in-Chief during the early stageswhen Respiratory Research was being set up. He played a very active and enthusiastic role ... of respiratory disease.FeedbackWe are keen to obtain your feedback on the format andcontent of Respiratory Research and welcome your sug-gestions for future commentaries, reviews and paperreports....
- 2
- 189
- 0
Báo cáo y học: " MDM2 is a novel E3 ligase for HIV-1 Vif" pot
... Hirofumi Akari8, Yoshio Koyanagi9, Jun Fujita3 and Takashi Uchiyama 1 Address: 1 Department of Hematology and Oncology, Graduate School of Medicine, Kyoto University, 54 Shogoin-Kawaracho, ... the research, and analyzed the data. HH, KItoh, and JFdesigned the research, contributed vital new reagents, andanalyzed the data. TU analyzed the data, drafted the paper, and organized the research.Retrovirology ... Kyoto University, 54 Shogoin-Kawaracho, Sakyo-ku, Kyoto 606-8507, Japan, 7Central Pharmaceutical Research Institute, Japan Tobacco Inc., 1- 1 Murasaki-cho, Takatsuki, Osaka 569 -11 25, Japan,...
- 12
- 692
- 0
Báo cáo y học: "Sequence homology: A poor predictive value for profilins cross-reactivity" ppt
... by a monoclonalantibody. J Biol Chem 19 96, 2 71: 29 915 -299 21. 30. Asturias JA, Gomez-Bayon N, Arilla MC, Sanchez-Pulido L, Valencia A, Martinez A: Molecular and structural analysis of the panal-lergen ... Proc Natl Acad SciUSA 19 87, 84:6 611 -6 615 .24. Chapman MD, Smith AM, Vailes LD, Arruda LK, Dhanaraj V, Pomés A: Recombinant allergens for diagnosis and therapy of aller-gic disease. J Allergy Clin ... (CAA69670 .1) A D H H T AA AF M.N.MK DE F FL.P.Banana (AAK54834 .1) A D L.D.D.QC A V.H DA C I .A. MK DE S L Latex (CAD37202 .1) T R A S F.S ITA.MS DE HL Peach (CAB 519 14 .1) A D D.D R A L S AT AF I .A. LK...
- 9
- 211
- 0
Báo cáo y học: " Landmark survival as an end-point for trials in critically ill patients – comparison of alternative durations of follow-up: an exploratory analysis" doc
... 1. 04 (1. 01 1. 07)* 1. 03 (1. 00 1. 05)* 1. 04 (1. 01 1. 07)* 1. 03 (1. 01 1. 05)* 1. 05 (1. 02 1. 08)*Organ score 1. 45 (1. 13 1. 85)* 1. 47 (1. 14 1. 89)* 1. 38 (1. 09 1. 74)* 1. 45 (1. 13 1. 85)* 1. 31 (1. 11 1. 54)*Trauma APACHE score 1. 28 (1. 16 1. 41) * 1. 28 (1. 16 1. 41) * 1. 25 (1. 15 1. 36)* 1. 22 (1. 13 1. 31) * 1. 18 (1. 12 1. 24)* 1. 13 (1. 05 1. 22)*APACHE ... 1. 01 (0.99 1. 04) 1. 02 (1. 00 1. 05) 1. 02 (1. 00 1. 05) 1. 03 (1. 01 1. 06)* 1. 02 (1. 00 1. 04)* 1. 05 (1. 02 1. 08)*APACHE score 1. 07 (1. 01 1. 13)* 1. 07 (1. 02 1. 13)* 1. 06 (1. 00 1. 11) * 1. 05 (1. 00 1. 11) 1. 05 (1. 01 1. 09)* 1. 04(0.99 1. 10)Charlson 1. 04(0.87 1. 23) 1. 00(0.85 1. 18) 1. 07(0. 91 1. 25) 1. 15(0.98 1. 35) 1. 08(0.98 1. 20) 1. 15 (1. 02 1. 30)*GCS ... 1. 11 (1. 02 1. 21) * 1. 08 (1. 01 1. 17)* 1. 09 (1. 02 1. 18)* 1. 07 (1. 00 1. 15)* 1. 06 (1. 01 1. 11) * 1. 04(0.97 1. 11) Charlson 1. 07(0.88 1. 29) 1. 12(0.94 1. 33) 1. 13(0.95 1. 35) 1. 11 (0.93 1. 33) 1. 06(0.96 1. 18) 1. 09(0.96 1. 22)GCS...
- 8
- 258
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenthư viện khoa học và y học library of the sciences and medicine http highwire stanford edu1 identification of the first locus for familial atrial fibrillation in 10q22báo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP