0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "Levels of protein C and activated protein C: what do they mean" doc

Báo cáo khoa học:

Báo cáo khoa học: "Comparison of Alignment Templates and Maximum Entropy Models for Natural Language Understanding" docx

... between source words and con-cepts. The corpora allocations are summarized intable 1 and table 2. For the TABA corpus, the tar-get language consists of 27 flat semantic concepts(23 concepts for ... caseframes (Issar and Ward, 1993), semantic frames(Bennacef et al., 1994), and variants of hierarchi-cal concepts (Miller et al., 1994) as well as flatconcepts (Levin and Pieraccini, 1995) are ... PP4.49rate. The CER describes the ratio of the sum of deleted, inserted, and substituted conceptsw.r.t. a Levenshtein-alignment for a given ref-erence concept-string, and the total number of concepts...
  • 8
  • 367
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Levels of protein C and activated protein C: what do they mean" doc

... meningococcal sepsis.Levels of protein C and activated protein C inacute diseaseLevels of PC have been studied extensively in several clinicalsituations, especially during meningococcal sepsis, ... Page 1 of 2(page number not for citation purposes)APC = activated protein C; PC = protein C. Available online http://ccforum.com/content/10/2/126AbstractAcute pancreatitis is a local inflammatory ... forms of sepsis [5]. Of interest is the study inCommentaryLevels of protein C and activated protein C: what do they mean?Jan A HazelzetErasmus MC, Sophia Children’s Hospital, Pediatric Intensive...
  • 2
  • 187
  • 0
Báo cáo khoa học: Prevalence of intrinsic disorder in the hepatitis C virus ARFP/Core+1/S protein doc

Báo cáo khoa học: Prevalence of intrinsic disorder in the hepatitis C virus ARFP/Core+1/S protein doc

... GGT G-3¢; HCV-1bCore+1/S sense, 5¢-ATC CGG GGT CTCCCATG GCAATG AGG GCC TGG GGT G-3¢; HCV-1a Core+1/Santisense, 5¢-AT CCG GGT CTCGGTACC TTA TCACGC CGT C TT CCA GAA C- 3¢; and HCV-1b Core+1/Santisense, ... Bre´chot) [69] and thefollowing primers: sense, 5¢-CAT GCC ATG GCA CCA ACCGCC GCC CAC A-3¢; and antisense, 5¢-CCCAAG CTTGGG GGG CGC CGA CAA GC-3¢ (underlined sequencesindicate NcoI and HindIII ... carbonchemical shifts and random coil values as afunction of sequence number. (C) SSP of HCV-1b Core+1/S. Carbon chemical shiftswere used to calculate the residue-speci c SSP scores of HCV-1b Core+1/S...
  • 16
  • 498
  • 0
Báo cáo khoa học: Role of the N- and C-terminal regions of the PufX protein in the structural organization of the photosynthetic core complex of Rhodobacter sphaeroides pptx

Báo cáo khoa học: Role of the N- and C-terminal regions of the PufX protein in the structural organization of the photosynthetic core complex of Rhodobacter sphaeroides pptx

... photosynthetic growth, theinsertion of PufX in the core LH1–RC complex, the stability of the dimers and the kinetics of flash-induced reduction of cytochrome b561 of the cytochrome bc1complex. ... hrlich,S., Chen, J. & Loach, P.A. (2001) Role of the core region of thePufX protein in inhibition of reconstitution of the core light-har-vesting complexes of Rhodobacter sphaeroides and Rhodobactercapsulatus. ... bacteriochlorophyll; cyt bc1, cytochrome bc1complex; ICM, intracytoplasmic membranes; LH, light-harvestingcomplex; PMC, photosynthetic membrane complex; QA,QB, primary/secondary electron...
  • 9
  • 547
  • 0
Tài liệu Báo cáo khoa học: Myristoylation of the dual-specificity phosphatase c-JUN N-terminal kinase (JNK) stimulatory phosphatase 1 is necessary for its activation of JNK signaling and apoptosis pdf

Tài liệu Báo cáo khoa học: Myristoylation of the dual-specificity phosphatase c-JUN N-terminal kinase (JNK) stimulatory phosphatase 1 is necessary for its activation of JNK signaling and apoptosis pdf

... Release of mitochon-drial cytochrome c triggers assembly of a caspase-9-activating complex and subsequent activation of thedownstream caspase cascade. These pathways are notmutually exclusive and ... attached to theculture dish. Since the detachment of cells and condensation of chromatin also occurs during mitosis[28], we tested the impact of the pan-caspase inhibitorZ-VAD-FMK on cell ... Associa-tion of mammalian cell death with a speci c endonu-cleolytic degradation of DNA. Nature 252, 754–755.42 Bain J, McLauchlan H, Elliott M & Cohen P (2003)The specificities of protein...
  • 11
  • 580
  • 0
Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt

Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt

... Diabetes, Metabolism and Endocrinology, Lund University, Sweden2 Department of Molecular Biophysics, Lund University, Sweden3 Department of Clinical Sciences, Division of Infection Medicine, Lund University, ... adipocytes,stimulation of lipolysis by catecholamines results inactivation of adenylate cyclase, leading to elevatedKeywordscholesterol ester hydrolase; electronmicroscopy; fluorescence spectroscopy;phospholipid ... Furthmayr H (1987) Electron microscopy and other physical methods for the characterization of extracellular matrix components: laminin, fibronectin,collagen IV, collagen VI, and proteoglycans. MethodsEnzymol...
  • 11
  • 562
  • 0
Tài liệu Báo cáo khoa học: Effect of ionic strength and oxidation on the P-loop conformation of the protein tyrosine phosphatase-like phytase, PhyAsr docx

Tài liệu Báo cáo khoa học: Effect of ionic strength and oxidation on the P-loop conformation of the protein tyrosine phosphatase-like phytase, PhyAsr docx

... enhanced thebinding of InsP6to PhyAsr (Table 1). Given the absence of structural changes as a function of ionic strength and ligand binding, the effect of ionic strength on catalyticactivity ... oxidation.DiscussionEffect of ionic strength on PhyAsr catalysis and P-loop structureChanges in ionic have been observed to affect the cata-lytic efficiency of some PTPs. For example, at high ionicstrength ... a consequence of this stericconstraint, the P-loop of Cdc25B also undergoes a largeconformational change upon oxidation of the catalyticcysteine (Fig. 3B).Sensitivity and reversibility of...
  • 10
  • 596
  • 0
Tài liệu Báo cáo khoa học: Interaction of the small heat shock protein with molecular mass 25 kDa (hsp25) with actin doc

Tài liệu Báo cáo khoa học: Interaction of the small heat shock protein with molecular mass 25 kDa (hsp25) with actin doc

... (1989)Dephosphorylation of cofilin accompanies heat shock-inducednuclear accumulation of cofilin. J. Biol. Chem. 264, 16143–16148.Ó FEBS 2003 Actin and small heat shock protein (Eur. J. Biochem. 270) 901nucleus ... excess heat capacity curve of G-actin can be fitted intotwo independent intermediate steps with Tm of 52 and 57 C, respectively. Therefore, the scheme of actin unfoldingis more complex and can ... for estimation of nativity of actin preparations. Corrected spectra of actinfluorescence excited at 297 nm were recorded in the range300–400 nm on the Hitachi F-3000 fluorescence spectro-photometer....
  • 10
  • 431
  • 0
Báo cáo khoa học: Mapping of the 45M1 epitope to the C-terminal cysteine-rich part of the human MUC5AC mucin potx

Báo cáo khoa học: Mapping of the 45M1 epitope to the C-terminal cysteine-rich part of the human MUC5AC mucin potx

... part of the figure shows an alignment of the N-terminalMUC5AC sequences of M-MUC5AC-CH-long and M-MUC5AC-CH-short and the corresponding sequences of human, rat and mouseMUC5AC. Long, M-MUC5AC-CH ... dimeric M-MUC5AC-CH; Monomer, monomericM-MUC5AC-CH; M-5AC-CH, reduced M-MUC5AC-CH; C2 -H, C- ter-minal cleavage fragment. The weak band corresponding to the C2 -H cleavage fragment is indicated ... the C- terminal cysteine-rich domain of human MUC2. Celllysates from CHO-K1 cells and CHO-K1 cells stably expressingeither M-MUC5AC-CH-long or the corresponding C- terminal cyste-ine-rich domain...
  • 9
  • 330
  • 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... D221KCLAP_1:GTCATAAGGAAACTCCCTCCTGATGTGATTAAACACCTTGTTGATGACCCAGCTCTCCTAAAAGAAGTTTTAACCTACCATGTCTTGTCTGGAACCTTCT 800 CLAP_2:GTCATAAGGAAACTCCCTCCTGATGTGATTAAACACCTTGTTGATGACCCAGCTCTCCTAAAAGAAGTTTTAACCTACCATGTCTTGTCTGGAACCTTCT ... CLAP_1:TTGAATGCTGTCACCACTGAGCCAGAAGCTAAGCTAGAACATGCTGCTATCCCTATCAAAGATGGTGAGGCAAAAAACCTTGTGGATCTTGCAGAGTCTC 200 CLAP_2:TTGAATGCTGTCACCACTGAGCCAGAAGCTAAGCTAGAACATGCTGCTATCCCTATCAAAGATGGTGAGGCAAAAAACCTTGTGGATCTTGCAGAGTCTC ... S155CLAP_1:CAAATTATGAAGCTCACAATGGTGTTCTGCATCTCCTTGAAGATGTGATTGTCTCTATACCAGCACGACATGGAACAGTGATTCACCAGCTGAGAAGATG 600 CLAP_2:CAAATTATGAAGCTCACAATGGTGTTCTGCATCTCCTTGAAGATGTGATTGTCTCTATACCAGCACGACATGGAACAGTGATTCACCAGCTGAGAAGATG...
  • 12
  • 772
  • 0

Xem thêm

Từ khóa: Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP