Báo cáo khoa học: "Clinical review: A systematic review of corticosteroid use in infections" ppt

Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx

... rather than adsorption on the enzymaticrate. Thus, the cellulase activity and initial rate data obtained from varioussamples may provide valuable information about the details of the mecha-nistic ... of untreated Avicel.Multivariate statistical analysis of X-ray dataThe CrI of cellulose samples was also calculated by quanti-fying the contribution of amorphous cellulose (PASC) andAvicel ... crystallinity and the change of the degree of crystallinity during enzymatic hydrolysis. It isaccepted that the initial degree of crystallinity of cellu-lose plays a major role as a rate determinant...

Báo cáo khoa học: "Clinical review: A systematic review of corticosteroid use in infections" ppt

... CD000972.58. Warrell DA, Looareesuwan S, Warrell MJ, Kasemsarn P, Intara-prasert R, Bunnag D, Harinasuta T: Dexamethasone provesdeleterious in cerebral malaria: a double blind trial in 100comatose patients. ... above, a recent Cochrane systematic review and accompanying publication re-examined the use of corticosteroids in septic shock [10,11]. Although there was Review Clinical review: A systematic review ... make appropriate graded recommendations.MethodologyThe Cochrane Database of Systematic Reviews, theDatabase of Abstracts of Reviews of Effects (DARE) and theCochrane Central Register of Controlled...

báo cáo khoa học: " Protocol: developing a conceptual framework of patient mediated knowledge translation, systematic review using a realist approach" doc

... Correspondence: anna.gagliardi@uhnresearch.ca1Departments of Health Policy, Management and Evaluation, University of Toronto, Toronto, CanadaFull list of author information is available at the end of the ... proposal,and obtained funding. ARG will lead and coordinate data collection andanalysis, interpretation, and report writing. She will be the primaryinvestigator to independently review and extract ... spanduring which research on patient involvement becameprevalent. Databases include MEDLINE (North Ameri-can), the Cochrane Library (systematic reviews, trials),EMBASE (European), and CINAHL...

Báo cáo khoa học: "Mucin pattern reflects the origin of the adenocarcinoma in Barrett''''s esophagus: a retrospective clinical and laboratorial study" ppsx

... adenocarcinoma arising in Barrett's esophagus (BE)may indicate the carcinogenesis pathway. The aim of this study was to evaluate resected specimens of adenocarcinoma in BE for the pattern of ... proximal Adenocarcinoma over a long Bar-rett's EsophagusFigure 6An infiltrative proximal Adenocarcinoma over a long Barrett's Esophagus. Undifferentiated adenocarcinoma arising in 10.7 ... was involved in collecting data, laboratoryinvestigation, carried out the immunoassays. All authorsread and approved the final manuscript.References1. Morales TG, Sampliner RE, Bhattacharyya...

Báo cáo khoa hoc:" Divine intervention? A Cochrane review on intercessory prayer gone beyond science and reason" pdf

... trial seems to be meant to amuse rather thanbeing a scientific study [4], in line with the tradition of this special issue, as the trial evaluated the effect of prayertaking place 4–10 years after ... life again. In fact, all the randomi-sation did was to divide the living and the dead into twogroups that were then compared statistically. This ismeaningless[4], also because we already knew ... mechanism need to interpretpositive results very carefully. A statistically significantresult is less convincing in a trial of prayer or homoeopa-thy than in a trial of a new non-steroidal, anti-inflamma-tory...

Tài liệu Báo cáo khoa học: "Beefmoves: Dissemination, Diversity, and Dynamics of English Borrowings in a German" ppt

... classi-ﬁer, using character 1- through 6-grams (includingword boundaries) as features. Since we could notmanually annotate a large portion of the MZEE cor-pus, the training data consisted of ... (anglicisms) are used in a German-language Internet hip hop forum, and whatfactors contribute to their uptake.1 IntroductionBecause English has established itself as something of a global ... Englishinclusions in mixed-lingual data with an applicationto parsing. Ph.D. thesis, Institute for Communicat-ing and Collaborative Systems, School of Informatics,University of Edinburgh.Eduardo...

Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

... antisense) for mouse Slc1 2a2 mRNA were designed asfollows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAATCACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACATCCTTGGTACCAGGTGATTTTTCTTGTGAAGAT.All experimental protocols ... site.Proc Natl Acad Sci USA 95, 14220–14225.18 Ohto H, Kamada S, Tago K, Tominaga S, Ozaki H,Sato S & Kawakami K (1999) Cooperation of Six andEya in activation of their target genes through ... Hatakeyama S, Nakayama K, Nagata M,Tomita K & Nakayama K (2001) Spatial and temporalexpression patterns of the cyclin-dependent kinase(CDK) inhibitors p27Kip1and p57Kip2during mousedevelopment....

Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, speciﬁcally expressed in the olfactory epithelium in a zone-speciﬁc manner doc

... (5¢-GAATTCatgaaggttctcctccactg-3¢)and rO-MACS-XhoI-D (5¢-CTCGAGtgcccgtccccactcctggt-3¢)for o-macs; EcoRI-mMACS1-U (5¢-GAATTCatgcagtggctgaagagttt-3¢) and mMACS1-XbaI-D (5¢-TCTAGAtagctgaccaaactccttg-3¢)forMACS1, ... Fujino, T., Takei, Y .A. , Sone, H., Ioka, R.X., Kamataki, A. ,Magoori, K., Takahashi, S., Sakai, J. & Yamamoto, T.T. (2001)Molecular identiﬁcation and characterization of two medium-chain acyl-CoA ... Theo-macs transcripts are detected in all cell layers; supporting cell layer(s), OSN layer (n), basal layer (b), and lamina propria (lp). The o-macsmRNA was not detected in the apical (a) or basal...

Báo cáo khoa học: "PREDICTIVE COMBINATORS A METHOD PROCESSING OF COMBINATORY CATEGORIAL GRAMMARS" doc

... combinators, that replace the basic forms of functional composition and type raising in the original grammar. After first reviewing the theory of Combinatory Categorial Grammar and the attendant ... Categorial Unification Grammars. In Proceedings of Coling 1986, pp. 187-194. Wittenburg, K. 198 5a. Natural Language Parsing with Combinatory Categorial Grammars in a Graph- Unification-Based ... Department of Linguistics University of Texas at Austin Austin, TX 78712 ABSTRACT Steedman (1985, 1987) and others have proposed that Categorial Grammar, a theory of syntax in which grammati- cal...

Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

... ATTTCAGCAGCATACTCCACAATAAAAAGPPP6C-siR-Top GATCCGCTTTGTGTAAGTAATTTGATTCAAGAATCAAATTACTTACAAGTTTTTTGAATTCTCGAGAPPP6C-siR-Bottom AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATTTGATCTCTTGAACAAATTACTTACACAAAGAGPPP6C-forward ... MicroRNA-373, a new regulator of protein phosphatase 6,functions as an oncogene in hepatocellular carcinomaNannan Wu*, Xuyuan Liu*, Xuemei Xu*, Xingxing Fan, Min Liu, Xin Li, Qiping Zhong andHua ... was used to quan-tify band intensities. Antibodies were purchased from Tian-jin Saier Biotech and Sigma-Aldrich.Statistical analysisData are expressed as mean ± standard deviation (SD),and...

Xem thêm