Báo cáo khoa học: " Penetration of the English language in science: the case of a German national interdisciplinary critical care conference" docx

Báo cáo khoa học: " Penetration of the English language in science: the case of a German national interdisciplinary critical care conference" docx

Báo cáo khoa học: " Penetration of the English language in science: the case of a German national interdisciplinary critical care conference" docx

... found that about one-quarter of the abstracts presented at a German medical conference were written in English, indicating a significant penetration of the English language into a German national ... German national interdisciplinary medical conference that has been attended mostly by German- speaking investigators was astounding. The fact that about one-...
Ngày tải lên : 12/08/2014, 23:20
  • 2
  • 481
  • 0
Báo cáo khoa học: 2-Oxo acid dehydrogenase complexes in redox regulation Role of the lipoate residues and thioredoxin pot

Báo cáo khoa học: 2-Oxo acid dehydrogenase complexes in redox regulation Role of the lipoate residues and thioredoxin pot

... lipoylated domains) [38], the physiological advantage of the E2 with the three lipoyl domains cannot be ascribed entirely to the catalytic role of these domains. Rather, the advantage appears to depend ... NADH/NAD + ratio and the complex-bound dihydro- lipoate/lipoate ratio. Redox state of the complex-bound lipoate is an indicator of the availability of the reacti...
Ngày tải lên : 17/03/2014, 09:20
  • 7
  • 407
  • 0
Báo cáo khoa học: Succinate dehydrogenase flavoprotein subunit expression in Saccharomyces cerevisiae – involvement of the mitochondrial FAD transporter, Flx1p ppt

Báo cáo khoa học: Succinate dehydrogenase flavoprotein subunit expression in Saccharomyces cerevisiae – involvement of the mitochondrial FAD transporter, Flx1p ppt

... AAGGAATGTC CTTCCGTACC TCCAACTGTA AGAGCCTACG CCGGTGCTGG ATC CGGT-3¢); and S2-SDH1-HA (5¢-TGCAATTAAA GAAG AGTATG ATATTCTTTT CCGTAAAATA CAATGAG- GTT CAAAGCATAG GCCACTAGTG GATCTG-3¢). The WT and EBY167-G418 S strains ... 5¢-TTAGT AGGCT CTTACAGTTG GAGGTACGGA AGGACAT TCC TTTTCGTCCA GCATAGGCCA CTAGTGGATC-3¢. The WT strain was transformed according to Gietz & Woods [52]. PCR analysis and on-p...
Ngày tải lên : 23/03/2014, 07:20
  • 15
  • 407
  • 0
Báo cáo khoa học: "Combining Source and Target Language Information for Name Tagging of Machine Translation Output" ppt

Báo cáo khoa học: "Combining Source and Target Language Information for Name Tagging of Machine Translation Output" ppt

... 1171 of them are the same. This means that 38.14% of the names tagged in the target language and 40.5% of those in the source language do not have a corresponding tag in the other language, ... we are interested not only in training a module, but also in measuring the different performance for different scales of training corpora. If a small annot...
Ngày tải lên : 31/03/2014, 00:20
  • 6
  • 288
  • 0
Báo cáo khoa học: "Sparse Information Extraction: Unsupervised Language Models to the Rescue" pptx

Báo cáo khoa học: "Sparse Information Extraction: Unsupervised Language Models to the Rescue" pptx

... Foundations of Statistical Natural Language Processing. M. Pas¸ca, D. Lin, J. Bigham, A. Lifchits, and A. Jain. 2006. Names and similarities on the web: Fact extrac- tion in the fast lane. In Procs. ... in the corpus that each extrac- tion appears in a context in which a seed also ap- pears (cf. (Ravichandran et al., 2005)). The first advantage of HMM-T is efficien...
Ngày tải lên : 31/03/2014, 01:20
  • 8
  • 287
  • 0
Báo cáo khoa học: "Choline PET based dose-painting in prostate cancer - Modelling of dose effects" potx

Báo cáo khoa học: "Choline PET based dose-painting in prostate cancer - Modelling of dose effects" potx

... 2003, 57(4):1116-1121. 48. Valdagni R, Italia C, Montanaro P, Lanceni A, Lattuada P, Magnani T, Fiorino C, Nahum A: Is the alpha-beta ratio of prostate cancer really low? A prospective, non-randomized trial comparing ... corresponding ASTRO value. Based on these assumptions the gain of a SIB is low, as the initial TCP is again very high (97.0%) and as the remaining SIB effec...
Ngày tải lên : 09/08/2014, 08:22
  • 9
  • 300
  • 0
Báo cáo khoa học: "Radiation Induced Temporal Lobe Necrosis in Patients with Nasopharyngeal Carcinoma: a Review of New Avenues in Its Management" doc

Báo cáo khoa học: "Radiation Induced Temporal Lobe Necrosis in Patients with Nasopharyngeal Carcinoma: a Review of New Avenues in Its Management" doc

... Southern China, particularly in Guangdong province and in the northern parts of Africa and Inuits of Alaska[1]. Till date radiotherapy remains the mainstay treatment of NPC[2]. A definitive radiation ... determinants. Br J Radiol 1992, 65:710-714. 6. Rubenstein LJ: Radiation changes in intracranial neoplasms and the adjacent brain. In Book Radiation changes in intr...
Ngày tải lên : 09/08/2014, 09:21
  • 23
  • 399
  • 0
Báo cáo khoa học: " Biomass production and stool mortality in hybrid poplar coppiced twice a year" ppt

Báo cáo khoa học: " Biomass production and stool mortality in hybrid poplar coppiced twice a year" ppt

... of dominants than those in the annual treatment, both in sum- mer and in winter. The larger number of dominants in the biannual coppice than in the annual coppice can ... total biomass. Total biomass production of the biannual treatment was 78% of the pro- duction of the annual treatment in the sec- ond year, 26% in the...
Ngày tải lên : 08/08/2014, 23:22
  • 7
  • 249
  • 0
báo cáo khoa học: "Reactivating aberrantly hypermethylated p15 gene in leukemic T cells by a phenylhexyl isothiocyanate mediated inter-active mechanism on DNA and chromatin" potx

báo cáo khoa học: "Reactivating aberrantly hypermethylated p15 gene in leukemic T cells by a phenylhexyl isothiocyanate mediated inter-active mechanism on DNA and chromatin" potx

... deacety lases [HDACs]) [7]. HATs are in charge of histone acetylation, leading to the relax ation of chromatin structure and transcriptional activation of genes, while HDACs are in charge of ... unmethylated form (154 bp) were tgtgatgtgtttgtattttgtggtt (positive sense) and ccatacaataaccaaacaaccaa (antisense). The amplification was performed in an Mastercycler unit (Eppendorf...
Ngày tải lên : 10/08/2014, 22:21
  • 6
  • 257
  • 0
Báo cáo khoa học: "Metabolism during anaesthesia and recovery in colic and healthy horses: a microdialysis study" docx

Báo cáo khoa học: "Metabolism during anaesthesia and recovery in colic and healthy horses: a microdialysis study" docx

... citation purposes) Example of lactate, glucose, and urea changes in dialysate and plasma in a colic horseFigure 6 Example of lactate, glucose, and urea changes in dialysate and plasma in a colic ... necessarily plasma lactate, compared to that in horses with a perfect and easy recovery. Lactate-to-pyruvate ratio Pyruvate, the precursor of lactate, and the La/Py ratio...
Ngày tải lên : 12/08/2014, 18:22
  • 13
  • 194
  • 0

Xem thêm

Từ khóa: