Báo cáo y học: "Practice of sedation and analgesia in German intensive care units: results of a national surve" pps

... Pain Therapy, Hospital am Eichert, Göppingen, Germany2Assistant physician, Department of Anesthesiology, Intensive Care Medicine and Pain Therapy, Hospital am Eichert, Göppingen, Germany3Assistant ... Berlin, Germany5Chairman, Department of Anesthesiology, Intensive Care Medicine and Pain Therapy, Hospital am Eichert, Göppingen, Germany6Professor of Anesthesiology and Chairman, Department ... analgesia, piritramid and NSAIDs in the different phases of analgesia and sedationEpidural analgesia, piritramid and NSAIDs in the different phases of analgesia and sedation. The values were tested...

Báo cáo y học: "2009 H1N1 Influenza and Experience in Three Critical Care Unit"

... defined as fever, cough, and headache, accompanied by one or more of the following signs or symptoms: rhinorrhea, coryza, arthralgia, myalgia, prostration, odynophagia, chest pain, abdominal ... used an alternative therapy for patients with acute respiratory failure with hopes of obviating intubation and mechanical ventilation. The results of NIMV in hypoxemic respiratory failure have ... critical care departments during winter of 2009 in Turkey. MATERIAL AND METHODS In response to an outbreak of influenza A virus infection in Mexico, Turkish Ministry of Health de-veloped a case...

Báo cáo y học: "Is succinylcholine appropriate or obsolete in the intensive care unit" docx

... corticosteroids,succinylcholine can contribute to rhabdomyolysis. It is likelythat cardiac arrest in such cases has an even higher mortalityrate than cardiac arrest in succinylcholine-inducedhyperkalaemia alone ... [8].Unpredictable activity In intensive care patients there is large variability in theactivity of plasma cholinesterase, an enzyme that metabolizesCommentaryIs succinylcholine appropriate or obsolete ... facilitate surgery byensuring an open airway. In the ICU these are absoluteindications, and rapid return of spontaneous ventilation is notnecessary, given that intubation is mainly indicated...

Báo cáo y học: "Clinical review: Acid–base abnormalities in the intensive care unit" doc

... gap.Critical Care April 2005 Vol 9 No 2 Kaplan and FrangosAbstractAcid–base abnormalities are common in the critically ill. Thetraditional classification of acid–base abnormalities and a ... associated with a significant increase in infection rate and mortality in majortrauma patients. J Trauma 2000, 48:8-14.Critical Care April 2005 Vol 9 No 2 Kaplan and Frangos200Critical Care April 2005 ... abnormalitiesthat were unappreciated using traditional classification and interpretation schemes [4].Lactic acidosis and hyperlactatemiaThe most common acid–base abnormality in trauma patientsis lactic acidosis...

Báo cáo y học: "Recently published papers: Heavyweight problems in the intensive care unit" potx

... There was noassociation between increased mortality and obesity. Therewas, however, an increase in morbidity with a trend towardslonger length of stay, both in the ICU and in the hospital,between ... not least the inconsistencies in measurement of height and weight (a simple yet seeminglyimpossible task to do well in the ICU) and the paucity of detailed data relating to mechanical ventilation ... Medicine add moreweight to the arguments against such views [2,3]. In the study by Sakr and colleagues, the European obser-vational Sepsis Occurrence in Acutely Ill Patients studydatabase was interrogated...

Báo cáo y học: "Self-reported asthma and allergies in top athletes compared to the general population - results of the German part of the GA2LEN-Olympic study 2008" pptx

... I, Tikkanen H, Haahtela T: Association between type of training and risk of asthma in elite athletes. Thorax 1997, 52:157-60.15. Helenius I, Tikkanen H, Sarna S, et al: Asthma and increased bronchialresponsiveness ... asthma medication: Are you cur-rently taking any medicines including inhalers, aero-sols or tablets for asthma?▪ Allerg ic rh initis: Do you have any nasal allergies,including hay fever?▪ Current ... shownthat prevalence of asthma and allergie s reached a pla-teau. As we had to rely on self-reported data it mightalso be that the reported respiratory symptoms of theathletes during and/ or after...

Báo cáo y học: "Homoeolog-specific retention and use in allotetraploid Arabidopsis suecica depends on parent of origin and network partners" doc

... expressionbetween At, Aa, and F1As. More than 15% of transcriptsAT1G65450.1GGTTTTAACCGCATACGCAAAGGAGAAATG CAAGGC ATTGCTTGAAGA GCCGTT TGGGAGGATTGT AGAAAT GGTAGG AGAAGGGTCAAA GAGGAT AACGGA TGAGTAT GCGCGGTCT ... T. G G A T T .G T C .G G A T T G T T C .G G A T. T .G T . GCAGTTTTAACTGCTTACGCAAAGGCGAAATG CAAGGC ATTGCTTGAAGA GCCGTT TGGGAGGATTGT GGAAAT AGTAGG TGATGGGGCAAA TAGGAT AACGGA TGAGTAT GCGCGGTCT ... within Aa and AtNote that although extant accessions of Aa, At,andF1Aswere used, As wasformed12to300KYA,perhapsfromdifferent accessi ons. DFs and Illumina resequencing maypotentially result...

Báo cáo y học: " High cell density and latent membrane protein 1 expression induce cleavage of the mixed lineage leukemia gene at 11q23 in nasopharyngeal carcinoma cell line" ppt

... cis-acting determinants of chromatin structural loops and functionaldomains. Curr Opin Genet Dev 1992, 2:275-285.32. Lagarkova MA, Iarovaia OV, Razin SV: Large-scale fragmentation of mammalian ... defining the site of chromosome rearrangement.BackgroundNasopharyngeal carcinoma (NPC) is a common cancer in Asia, especially in Southern China and South East Asia[1]. NPC is well associated ... protein 1expression induce cleavage of the mixed lineageleukemia gene at 11q23 in nasopharyngealcarcinoma cell linePeter Han-Chung Yee, Sai-Peng Sim*AbstractBackground: Nasopharyngeal carcinoma...

Báo cáo y học: "Severe community-acquired adenovirus pneumonia in an immunocompetent 44-year-old woman: a case report and review of the literature" ppsx

... negative.Her nasopharyngeal and tracheal samples were negativefor influenza A and B (including H1N1), respiratory syn-cytial virus (RSV) types A and B and parainfluenza virus(PIV) types 1 thr ... noted reasonably frequently(24%).Intubation and mecha nical ventilation were required in 67% of patients and occur red at a median of one and half days following admission. Overall 24% of patientsdied. ... pattern commonlyseen with primary influenza pneumonia [27]. Laboratoryfindings are also typical of viral infecti on, with a normalTable 1 The demographic, clinical, laboratory,radiological...

Báo cáo y học: " Immunoglobulin G galactosylation and sialylation are associated with pregnancy-induced improvement of rheumatoid arthritis and the postpartum flare: results from a large prospective cohort study" pot

... N-glycan sialylation was larger in responders than in non-Figure 2Mean galactosylation of IgG1 and IgG2 in cases and controls during pregnancy and postpartumMean galactosylation of IgG1 and ... wereperformed. These revealed that mainly disease activity and timepoint in pregnancy remained as an explanatory parameterfor galactosylation. However, in the multivariate analysis alsouse of prednisone ... Imafuku Y, Yoshida H, Yamada Y: Reactivity of agalactosyl IgGwith rheumatoid factor. Clinica chimica acta; international jour-nal of clinical chemistry 2003, 334:217-223.17. Axford JS: Glycosylation...

Xem thêm

Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống chuyên đề điện xoay chiều theo dạng Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ