Báo cáo khoa học: "Assessment of six mortality prediction models in patients admitted with severe sepsis and septic shock to the intensive care unit: a prospective cohort study" ppt
Báo cáo khoa học: "Assessment of six mortality prediction models in patients admitted with severe sepsis and septic shock to the intensive care unit: a prospective cohort study" ppt
... are proved to predict accurately mortality in severe sepsis and septic shock, then they will have the advantage of being readily available and easily incorporated into generalICU databases without ... Al-Shimemeri11Department of Intensive Care, King Fahad National Guard Hospital, Riyadh, Saudi Arabia2Department of Infection Prevention and Control, King Fahad National Guard Hospital, Riyadh, Saudi ArabiaCorrespondence: ... the validity of mortality prediction systems in patients admitted to the intensive care unit (ICU) with severe sepsis and septic shock. We includedAcute Physiology and Health Evaluation (APACHE)...
- 7
- 273
- 0
Báo cáo khoa học: " Assessment of Early Postpartum Reproductive Performance in Two High Producing Estonian Dairy Herds" doc
... baseline at the same time as the final elimination of bacteriaoccurs (Bekana et al. 199 6a) . This implies thatan increased release of PGF2αis an indication of the infection /in ammation in the ... (at 114 pmol/l) and the intra-assay coefficient of variation variedbetween 6.6% and 11.7% at different ranges of standard curve. The duration in days of the PP prostaglandin re-lease was calculated ... kg/day in Farm A respectively. None of the animals haddifficult calving and retained fetal membranes.No treatment was given to the animals eitherbefore or after calving. During the last week of the...
- 13
- 245
- 0
báo cáo khoa học: "Effect of growth hormone replacement therapy in a boy with Dent’s disease: a case report" ppt
... 1.53 standard deviations higher than at the initiation of growth hormone therapy. His global kidney functions and levels of proteinuria and calciuria remained relativelystable. In spite of the ... palate and slight genusvalgus, he had no other abnormalities. His blood pres-surewasnormalandhisboneagewas5years .A laboratory test was positive for proteinuria. He had anelevated urinary calcium ... to have extrarenal manifestations such asmild intellectual impairment, hypotonia and cataracts, and such patients have been reported to share a muta-tion in OCRL1 with the oculocerebrorenal...
- 6
- 342
- 0
báo cáo khoa học: " Distribution of short interstitial telomere motifs in two plant genomes: putative origin and function" pptx
... TGGGCTTTTACCATAAACTATTTATGAAAATTATTATGGCCCACACCACTATAACTAAAGCCCACATATTTAGCAGCCCAGTTTCATTGTAAGAGACATGTTCGCTCTGGAACTAGAATTTTCTGGTTTTTGGGTATTTGTTTTCTTATGTGTAGAGAAATGATGGTAACGATTAAATGTTGTGTATTACAATTTACAATGGTAAGACGATTAATATATTTACACACAATTTTGTTGTTGCTGTAACACGTTAGTGTGTGTGATGATAGAATTTCATAAAGCTTTAACTACGAGGGGCAAAATGTTAATTCTAAATAGTTGACAGCAGAAAAAGATATGTATACATAATATAAGGATTAAAACGTAAATAATAATAAATAAGGCGAGTTAAATTAAAACCCTGTTAAAACCCTA…O.sativa ... protein TAGGGCCCATTTTAGATTTCTTTAAAAGATCCGAGAGAGAGAGGGATCTAATTCCTGATAAACCCTAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGCAAAACCTGTGGAGATCGAGATG Os07g08330 – 60S rp L4-1 AAACCCTAGCAACCCCCCACCTATATAACCTCTCTCCCTCACGCCCCGCCTCCATTCGCACGCCCGCGCCACCACAAAACCCTAGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCATGFigure ... grey. A, CTAAACCC and TCAAACCT; B, TAAACCCT and CAAACCTC; C, AAACCCTA and AAACCTCA; D, AACCCTAA and AACCTCAA; E, ACCCTAAA and ACCTCAAA; F,CCCTAAAC and CCTCAAAC; G, CCTAAACC and CTCAAACC.Gaspin...
- 12
- 426
- 0
Báo cáo y học: " Distribution of hepatitis C virus genotypes in patients infected by different sources and its correlation with clinical and virological parameters: a preliminary study" pptx
... sequencealignment and the immunoassays, and also drafted the manuscript. AK and S-MA conceived and coordinated the study, helped to draft the manuscript, and made the sta-tistical analysis. All authors ... mixed infection with genotype 1a and 1b only in center. In this study, the dominant genotype(s) in different regions of Iran consist: 1a, 1b and 3a in center and west, 1a and 3a in north and 1a in ... 53:3-4.7. Alavian SM, Einollahi B, Hajarizadeh B, Bakhtiari S, Nafar M, Ahrabi S:Prevalence of hepatitis C virus infection and related risk fac-tors among Iranian hemodialysis patients. Nephrology...
- 6
- 337
- 0
Báo cáo khoa học: Assessment of porcine and human 16-ene-synthase, a third activity of P450c17, in the formation of an androstenol precursor doc
... encoding cyt b5 and monitored the formation of androstadienol and DHEA. As shown in Fig. 5 the stimulation of DHEA and androstadienolproduction from preg increases with increasing amounts of ... time of nonlabeled commercialandrostadienol monitored using UV at 216 nm. This datashows that one of the metabolites obtained in assays usinghuman and porcine P450c17 is androstadienol. In addition to ... respectively(Fig. 2). In both porcine and human assays using preg as a substrate, an additional peak of elution appeared at15 min (panels C and D, respectively). This additional peakcoincides with the elution...
- 7
- 612
- 0
Báo cáo khoa học: Assessment of telomere length and factors that contribute to its stability potx
... end-joining.Therefore, the telomere, its structural motifs and length,as well as recombination mechanisms and telomerase,all appear to be integral to maintaining the structural and functional integrity ... for Aging and 3Comprehensive Cancer Center, University of Alabama at Birmingham,University of Alabama at Birmingham, AL, USAShort strands of tandem hexameric repeats known astelomeres cap the ... important as the signals emitted by these probes areused in the quantification and analysis of the data. Severalprobes/dyes have been used in staining surface, integral orcytoplasmic proteins and...
- 15
- 387
- 0
Báo cáo khoa học: "Assessment of Replication and Virulence of Attenuated Pseudorabies Virus in Swine" pdf
... University of Georgia for technical assistance with RFLP assays, and Mike Meetz and Teresa Baker at the Iowa State UniversityVeterinary Diagnostic Laboratory for technical assistance with serology and ... Fritsch, and T. Maniatis.Molecular Cloning: A Laboratory Manual. Cold SpringHarbor Laboratory Press, New York, 1989.[18]U.S. Food and Drug Administration.NonclinicalLaboratory Studies: Good Laboratory ... processed and assayed as describedabove for the first passage. A second attempt at a second animal passage was madeusing pooled tissue homogenates obtained from all 6 pigsduring the first viral passage...
- 6
- 260
- 0
Báo cáo khoa học: "Assessment of Porcine Reproductive and Respiratory " pot
... and the rate of viral RNA clearance in individual animals wascalculated by regression analysis (Table 1).Correlation analysis between the rate of viral RNAclearance and viral RNA load in serum and ... circulation, and to gain insights into relationship between viral clearance rate and viral RNA load in different tissues.Materials and MethodsCollection of sera and tissues A total of 30, 6 to ... analysis was performed usingviral RNA quantity data obtained from a total of 25 infectedpigs, it showed that viral RNA was cleared away at the rate of 0.37 day on a log10 scale (i.e., 2.7 days to...
- 11
- 336
- 0
Báo cáo khoa học: "Histochemistry of Six Lectins in the Tissues of the Flat Fish Paralichthys olivaceus" potx
... including peanut agglutinin, wheatgerm agglutinin, phytochemagglutinin E, concanavalin A, Dolichos biflorus agglutinin (DBA), soybean agglutinin (SBA) and Bandeiraea simplicifolia BS-1 (isolectin ... the six lectins examinedw ere localized in the cove ring epithelia of the variousorgans of the flat fish and they may participate in the biodefense mechanism of the intra body surface in w ... Gyung-Min Go and Tae-Kyun Shinfish biodefense. The aim of this study was to localize six lectins includingDBA, SBA, isolectin B4, WGA, PNA and UEA-I, in the various tissues of the flat fish Paralichthys...
- 9
- 283
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015