Báo cáo khoa học: "Metabolic profiles in five high-producing Swedish dairy herds with a history of abomasal displacement and ketosis" ppsx
Báo cáo khoa học: "Metabolic profiles in five high-producing Swedish dairy herds with a history of abomasal displacement and ketosis" ppsx
... CentralPage 1 of 11(page number not for citation purposes)Acta Veterinaria ScandinavicaOpen AccessResearchMetabolic profiles in five high-producing Swedish dairy herds with a history of abomasal ... metabolic profiles, reflecting both energy metabolism and liver status around calving in high-producing herds with a high incidence of abomasal displacement and ketosis and to evaluate if such profiles ... long-term high inci-dence of DA and had a reported incidence above the Swedish average of abomasal displacement (1.0%) and herds A, B and C had reported incidences above the aver-age for ketosis...
- 11
- 293
- 0
Báo cáo khoa học: Metabolic control in integrated biochemical system doc
... transcription and mRNA degradation rates. Parameter values are indicated as in Table 1, except that the rate constants on the translational level were k3¼ 10 and k4¼ 1, and the rates on the level of ... Physiology and Mathematical Biochemistry, BioCentrum Amsterdam, Amsterdam, the NetherlandsTraditional analyses of the control and regulation of steady-state concentrations and fluxes assume the activities of ... followedby analysis with the traditional MCA approach, as if it was a true steady-state. This has led to an emphasis on smallchanges (perhaps smaller than may be experimentallyfeasible), steady-states,...
- 10
- 210
- 0
Tài liệu Báo cáo khoa học: Antioxidant defences in cybrids harboring mtDNA mutations associated with Leber’s hereditary optic neuropathy docx
... Napoli1,2, Andrea Martinuzzi2, Giorgia Pantano2, Valentina De Riva2,Roberta Trevisan1,2, Elena Bisetto1,2, Lucia Valente1, Valerio Carelli3 and Federica Dabbeni-Sala11 Department of Pharmacology ... cybrids in gal-DMEM. In contrast,GSH markedly increased in cells carrying the3460 ⁄ ND1 and 11778 ⁄ ND4 mutations, which onceagain showed similar behavior. A 12-h incubation in galactose caused a ... total amount of GSH in the samples was determined from a standardcurve obtained by plotting known amounts (0.05 to0.4 lgÆ mL)1) of GSH against the rate of change in A 412.GSH standards were...
- 12
- 548
- 0
Báo cáo khoa học: "Tongue carcinoma in an adult Down''''s syndrome patient: a case report" potx
... RS, Garden AS, Frankenthaler RA, et al.:Evaluation of the dose for postoperative radiation therapy of head and neck cancer: first report of a prospective rand-omized trial. Int J Radiat Oncol ... The patient wasoffered radical salvage surgery that was declined by thepatient and his family. The patient received 2 cycles of weekly Docetaxel (30 mg/m2) and weekly Carboplatin(area under ... the case, and helped with pathological sections in the manuscript.All authors have read and approved the final version of the manuscript.References1. Stage D, Benard J: Carcinogenesis in Down...
- 4
- 516
- 0
Báo cáo khoa hoc:" Retroperitoneal haemorrhage in renal angiomyolipoma causing hepatic functional decompensation: a case report" ppsx
... 'Lenk's triad' of symptoms include flank or abdominal pain, a palpableor tender mass and haematuria4. Other symptoms mayinclude fever, vomiting, anaemia, renal failure and hypo-tension ... multiple,bilateral and are associated with rapid growth and anincreased risk of haemorrhage [4,7]. A sporadic and rareform of angiomyolipoma is also found where lesions areSelective right renal artery ... thispotentially life-threatening complication.BackgroundRenal angiomyolipomata are incidental findings that usu-ally remain clinically silent in the majority of cases [1].However, in a small minority...
- 5
- 194
- 0
báo cáo khoa học: " Pollen development in Annona cherimola Mill. (Annonaceae). Implications for the evolution of aggregated pollen" pdf
... that originally looked outwardsrotate inward to face each other. A similar rotation hasbeen reported previously in other Annonaceae [A. glabra and A. montana [22] and Cymbopetalum [23], and also ... proxi-mal reduction of the exine in Annonaceae [59]. A. cher-imola pollen is inaperturate and germinates in theproximal face, showing a large area of unprotected intine[47,60]. More evolutionarily ... thinner in the pollen aperture site. Longitudinal section stained with a 3:1 mixture of Auramine and Cal-cofluor. (B) Sibling pollen grains have a faint cohesion that showed with JIM 5 antibody...
- 10
- 338
- 0
Báo cáo khoa học: "Steroid use in PROWESS severe sepsis patients treated with drotrecogin alfa (activated)" pot
... mortality associated with severe sepsis and/ or septic shock [22]. Adrenal replacement therapy in patients with adrenal failure may be a logical addition to standard care in patients with severe ... characteristics (e.g. age) were analyzed using one-way analysis of variance. Categorical baseline characteristicswere analyzed using Pearson's χ2 test.Figure 1Patient populationPatient ... criteria. Steroids received at baseline and/ or during the infusion period. AEC = Annane enrollment criteria; DrotAA, drotrecogin alfa (activated); PROWESS, Recombinant Human Activated Protein C...
- 6
- 167
- 0
Tài liệu Báo cáo khoa học: Purified RPE65 shows isomerohydrolase activity after reassociation with a phospholipid membrane pdf
... 3027cellular retinaldehyde-binding protein. After 2 h of incuba-tion at 37 °C in the dark, the generated retinoids wereextracted with 300 lL of methanol and 300 lL of hexane and analyzed by normal-phase ... activity afterreassociation with a phospholipid membraneOlga Nikolaeva, Yusuke Takahashi, Gennadiy Moiseyev and Jian-xing MaDepartments of Cell Biology and Medicine Endocrinology, Harold Hamm Oklahoma ... lipid amount in each flotation fractionwas quantified by scintillation counting of [14C]PC and expressed as a percentage of the total amount of [14C]PC in the gradient(means ± standard deviation,...
- 11
- 587
- 0
Báo cáo khoa học: Human ATP-dependent RNA ⁄ DNA helicase hSuv3p interacts with the cofactor of survivin HBXIP ppt
... GGATCCATGGTCATGGAAACATATCCATAAATCGG and CCATCCATGGTCAGTTGATAGGAGCTGTGAAGAAAAC, respectively (all incorporating NcoIsite, underlined). The resulting fragments were cloned intopEG202 using EcoRI and ... plasmid encoding TAP-tag only was gener-ated similarly to pchSUV3-650–786-TAP with the exceptionthat the forward primer had the following sequence:CGTCTCGAGATGGAAA AGAGAAGA TGGAAA AAGAATTTC ... CCATAAGCTTCACAGGTCCTCCTCGGAGATCAGCTTCTGCTCAGAGGCCATTTTGTGCACTGCC introducing c-myc epitope cod-ing sequence (italic) and Hind III site (underlined); forpcHBXIP-HA CCATAAGCTTCAGAGGCTAGCGTAATCCGGAACATCGTATGGGTAAGAGGCCATTTTGTGCACTGCC...
- 12
- 468
- 0
Báo cáo khoa học: Human mesotrypsin exhibits restricted S1¢ subsite specificity with a strong preference for small polar side chains docx
... in bands migratingbetween the free a1 AT and the intact serpin–proteasecomplex. Mutating Arg122 to Ala (R12 2A) in cationic and anionic trypsins abolished the major proteolyticbands, confirming ... cationic and anionictrypsins, demonstrating that Arg198 is the criticaldeterminant of resistance against a1 AT (Fig. 2A, B).Figure 2A also indicates that the apparent stoichio-metry of inhibition ... specificity and accommodates only small, hydrophilic side chains.Mesotrypsin is inactivated by a1 AT PittsburghThe natural Pittsburgh variant of a1 AT contains anArg residue in place of the P1 Met358 in...
- 13
- 433
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo quy trình mua hàng CT CP Công Nghệ NPVđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ