0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo sinh học: "Bactericidal activity of oxacillin and glycopeptides against Staphylococcus aureus in patients with endocarditis: Looking for a relationship between tolerance and outcome" doc

Báo cáo sinh học:

Báo cáo sinh học: "Bactericidal activity of oxacillin and glycopeptides against Staphylococcus aureus in patients with endocarditis: Looking for a relationship between tolerance and outcome" doc

... 10:26http://www.ann-clinmicrob.com/content/10/1/26Page 4 of 7RESEARCH Open AccessBactericidal activity of oxacillin and glycopeptides against Staphylococcus aureus in patients with endocarditis: Looking for a relationship between tolerance ... Westudied bactericidal activity of oxacillin, vancomycin and teicoplanin against Staphylococcus aureus isolates in patients with endocarditis and then we sought to determine if there was a relationship ... rate of tolerance to oxacillin, vancomycin and teicoplanin among S .aureus isolates in patients with IE. Thereafter, we sought todetermine a relationship between in vi tro bactericidaltests and...
  • 7
  • 356
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "High activity of sequential low dose chemo-modulating Temozolomide in combination with Fotemustine in metastatic melanoma. A feasibility study" pptx

... MJ, et al: Activity of fotemustine in medulloblastoma and malignant glioma xenografts in relation to O6-alkylguanine-DNA alkyltransferase and alkylpurine-DNA N-glycosylase activity. Clin Cancer ... limit in 3 patients. According to AJCC melanoma staging [2],2 patients had M 1a staging, 4 patients had M1b staging, and 8 patients had M1c staging. Two patie nts had only1 metastatic site; 7 patients ... interferon-alpha2b,interleukin-2 and fotemustine for patients with metastatic melanoma.Melanoma Res 2000, 10(5):475-82.12. Avril MF, Armadal S, Grab JJ, et al: Fotemustine compared with Dacarbazine in...
  • 8
  • 459
  • 0
Báo cáo y học:

Báo cáo y học: "The effects of long-acting bronchodilators on total mortality in patients with stable chronic obstructive pulmonary disease" pdf

... accounting of all randomized patients in the study and reported excellence balance in terms of patient characteristics and clinical status between the active treatment and comparator arms. Sec-ondly, ... Foundation for Health ResearchDDS is a Canada Research Chair in COPD and a senior scholar with the Michael Smith Foundation for Health Research (MSFHR) and LL is a New Investigator with CIHR and a ... Tashkin DP, McElhattan J, Goldman M, Ramachandran S, Martin UJ, Silkoff PE: Efficacy and tolerability of budesonide/formoterol in one hydrofluoroalkane pressurized metered-dose inhaler in patients...
  • 13
  • 437
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Polymerase activity of hybrid ribonucleoprotein complexes generated from reassortment between 2009 pandemic H1N1 and seasonal H3N2 influenza A viruses" ppt

... Tamura D, Sakai-Tagawa Y, Noda T et al.: In vitro and in vivo characterization of new swine-origin H1N1 influenza viruses. Nature 2009, 460:1021–1025. 3. Kashiwagi T, Hara K, Nakazono Y, Hamada ... endonuclease activity, cap binding, and virion RNA promoter binding. J Virol 2006, 80:7789–7798. 18. Obayashi E, Yoshida H, Kawai F, Shibayama N, Kawaguchi A, Nagata K, Tame JR, Park SY: The ... and involves in promoter and cap binding [20,21]. PB1 contains active sites for nucleotide elongation [22,23] and binding to promoters of vRNA and cRNA [22,24,25]. PB2 involves in cap-snatching...
  • 15
  • 237
  • 0
báo cáo sinh học:

báo cáo sinh học:" Nurses'''' experiences of recruitment and migration from developing countries: a phenomenological approach" pdf

... 2001,10(4):254-265.34. Charest CA: Analysis of a transcultural innovation: the social-isation of Filipino-graduate nurses into an acute health careorganisation in the United States. In Graduate School Volume Doc- tor ... nursing workforce in sub-Saharan Africa. In Issue Paper no 7 Geneva , International Council of Nurses; 2005. 29. Kline D: Push and pull factors in international migration. Jour-nal of Nursing ... faced with increased workloads and rising stresslevels. This has lead to increased sick leave and absentee-ism, further de-motivating the remaining staff. As an indi-cation of the seriousness of...
  • 7
  • 473
  • 0
báo cáo sinh học:

báo cáo sinh học:" The role of nurses and midwives in polio eradication and measles control activities: a survey in Sudan and Zambia" pdf

... Khartoum, Sudan and 5World Health Organization Country Office, Lusaka, ZambiaEmail: Annette Mwansa Nkowane* - nkowanemwansa@who.int; Liliane Boualam - boualaml@who.int; Salah Haithami - haithamis@sud.emro.who.int; ... proposal, discussions, dataanalysis and review of the article. SH, ETAES and HM wereinvolved in data collection, discussion and review of arti-cle. All authors have read and approved the final ... other hand, in Zambia, nurses and midwives were involved in the full range of functions for SIAs and AFP surveillance.Survey of nurses and midwives working at health facilitiesRoutine tasks and...
  • 8
  • 628
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " PET kinetics of radiolabeled antidepressant, [N-methyl-11C]mirtazapine, in the human brain" ppt

... temporal cortices, intermediate binding potential in the thalamus, and low binding potentials in the striatum, hypothalamus, and brainstem. Thereafter, we initiated PET studies with arterial sampling ... [N-methyl-11C]mirtazapine data, perhaps resulting in biased estimates of parameters. The values for the binding potential of [N-methyl-11C]mirtazapine obtained by method A were, for instance, markedly ... F) for the binding potential values. Table 5 compares Akaike values for fits of the data by methods A, B, E, and F, the methods that use all data points for estimating the binding potential....
  • 18
  • 432
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Therapeutic effects of pyrrolidine dithiocarbamate on acute lung injury in rabbits" ppt

... performing study and editing manuscriptXDW: making study plan and advising data analysis aswell as writing manuscriptJH: making study plan and advising data analysis aswell as writing manuscriptAll ... wax, stained with hematoxylin and eosin, and examined under a light microscope. The lung injury wasscored according to inflammatory changes, hemorrhage of alveoli and interstitial tissue, and ... and incubated for 2 h, the plates werewashed, and a biotinylated secondary antibody wasadded and incubated for 2 h. Plates were washed again, and streptavidin boun d to horseradish peroxidase...
  • 9
  • 799
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Spectratyping analysis of the islet-reactive T cell repertoire in diabetic NOD Igμnull mice after polyclonal B cell reconstitution" potx

... stimulated with anti-CD3/CD28 beads and 5-daysupernatants were screened by cytokine bead assays (average and SD of 3 animals).Vong et al. Journal of Translational Medicine 2011, 9:101http://www.translational-medicine.com/content/9/1/101Page ... of cytokine production, in vitro stimula-tion of lymphocytes isolated from pancreas with anti-CD3 and anti-CD28 b eads (Invitrogen Dynabeads) wasperformed, and 5 day supernatants were a nalyzed ... performed early, at 4 weeks of age by a chimera approach (to bypass the MHC class I-mediated* Correspondence: cgabaglia@san.rr.comLaboratory of Vaccine Research, Torrey Pines Institute for...
  • 10
  • 447
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Persistent expression of chemokine and chemokine receptor RNAs at primary and latent sites of herpes simplex virus 1 infection" pptx

... CACCTCAGTCACCTGCATGGCCACCR5ACTGCTGCCTAAACCCTGTCA GTTTTCGGAAGAACACTGAGAGATAA TCCGGAACTTCTCTCCAACAAAGGCACCR6TTGGTGCAGGCCCAGAAC GAACACGAGAACCACAGCGAT CCAAGAGGCACAGAGCCATCCGACCR7CTGCTACCTCATTATCATCCGTACCT TGATCACCTTGATGGCCTTGT ... CAGCCATTTTGCCAGTGGTA ACATGCCTTTGAAACAGCTGCCGAACCR2ATGAGTAACTGTGTGATTGACAAGCA GCAGCAGTGTGTCATTCCAAGA CTCTGTCACCTGCATGGCCTGGTCTCCR3ACCAGCTGTGAGCAGAGTAAACAT CACAGCAGTGGGTGTAGGCA CACCTCAGTCACCTGCATGGCCACCR5ACTGCTGCCTAAACCCTGTCA ... TGATCACCTTGATGGCCTTGT CTCCAGGCACGCAACTTTGAGCGCXCR3TGTAGTTGGGCTAGCTCGAACTT ACCTGGATATATGCTGAGCTGTCA GCATCCTGGCAGCAAAGTTACGGGCXCR4CTCCAAGGGCCACCAGAA GGCAAAGAAAGCTAGGATGAGG CGCAAGGCCCTCAAGACGACAGTCChemokineMIP-1αTCATCGTTGACTATTTTGAAACCAG...
  • 12
  • 307
  • 0

Xem thêm

Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ