Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc
Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc
... fwd ACGTTGGATGGGGCACCAATTAACTAAGGC
rev ACGTTGGATGTGAGGGCATGGAAGGTTCAG
GCCGGCTCCCAAGCTCC 92.03
S1 rs3918396 G /A 0.09 0.09 fwd ACGTTGGATGAGTCGGTAGCAACACCAGGC
rev ACGTTGGATGAATCCCCGCAGACCATGACAC
CCTGCTGGCCATGCTCCTCAGC ... 12
(page number not for citation purposes)
Respiratory Research
Open Access
Research
The role of polymorphisms in ADAM33, a disintegrin and
metalloprotease...
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf
... CTTGCATGCCCTGCAGGTCG
Mutagenic L73G Forward GTATTCAAAAGTGGTCCCGGACAAAATGAG GACTTG
Reverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT
P74G Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC
Reverse CATTTTGTCCGCCAAGACTTTTGAATACTT ... binding loop of cystatin A fulfils the
same function as the second binding loops of cystatin B and
family 2 cystatins and also what residues of this loop...
Báo cáo Y học: The role of hydrophobic active-site residues in substrate specificity and acyl transfer activity of penicillin acylase pdf
... may
in uence the shape and volume of the acyl binding pocket
and thereby alter the binding mode and affinity of the
enzyme for PAA and derivatives thereof, while maintaining
the hydrophobicity of ... The
bF24rv mutagenic primer was 5¢-ATAAGTATACGCAG
GCGCATACCAGCC
AAACTGCGGGCCATTTAC-3¢
and the bF57rv mutagenic primer was 5¢-GGAAATC
ACACCATTATGACCA
AAAACCAGCCCGGGAT...
Báo cáo Y học: The role of zinc in the methylation of the coenzyme M thiol group in methanol:coenzyme M methyltransferase from Methanosarcina barkeri New insights from X-ray absorption spectroscopy doc
... activity
and in distinct changes in the zinc ligands. In the
His237 fi Ala and Cys239 fi Ala mutants, coenzyme M
also seemed to bind efficiently by ligation to zinc indicating
that some aspects of ... zinc.
XANES spectra of wild-type and mutants
As shown in the following, the interpretation of the EXAFS
of the mutant enzymes is confirmed by a comparative
analysi...
Báo cáo Y học: The role of arginine residues in substrate binding and catalysis by deacetoxycephalosporin C synthase potx
... proposed roles for these residues in
binding the carboxylate linked to the nucleus of penicillin N
(Arg160 and Arg162) and the carboxylate of the a- amino-
adipoyl side-chain (Arg266). The results ... Taiwan;
3
Department of Pharmacy and Pharmacology, The University of Bath, UK
Deacetoxycephalosporin C synthase (DAOCS) catalyses the
oxidative ring expansion of...
Báo cáo y học: "The role of Probiotics in allergic diseases" pptx
... scores, the use of
heat-inactivated Lactobacillus GG was associated with
adverse gastrointestinal symptoms and further study
enrollment was thus halted.
Another study by Kirjavainen et al suggested ... composition of gut microbiota
of allergic infants. a target of bifidobacterial therapy at wean-
ing? Gut 2002, 51(1):51-5.
8. Kirjavainen PV, et al.: Characterizing the composit...
Báo cáo y học: "The role of cyclooxygenase-2 in bone repair" doc
... func-
tional activity of a glucocorticoid-regulated inflammatory
cyclooxygenase. Proc Natl Acad Sci USA 1992, 89:4888-4892.
7. Raskin JB: Gastrointestinal effects of nonsteroidal anti-inflam-
matory therapy. ... manage
acute pain. Moreover, whereas the use of these drugs in
the management of acute pain is typically short term (a
few days to two weeks), their continuous usag...
Báo cáo y học: "The role of hypoxia and HIF-dependent signalling events in rheumatoid arthritis" ppt
... of
α-subunits, and two transactivating domains, namely the
amino-terminal transactivating domain and the carboxyl-
terminal transactivating domain (C-TAD). The C-TAD has
been shown to interact with co-activators ... activating
angiogenesis, hypoxia may regulate many other features that are
important in RA, such as cell trafficking and matrix degradation. An
understanding of...
Báo cáo y học: "The role of osteoprotegerin in arthritis" ppsx
... Weichselbaum in the Archives for
Pathology, Anatomy, Physiology and Clinical Medicine in 1878. (c)
Title of the manuscript, meaning The finer changes of joint cartilage in
fungous synovitis and caries ... Nagashima M, Yamamoto M, Nishijima T, Katsumata
S, Yoshino S: Bone resorption and inflammatory inhibition effi-
cacy of intermittent cyclical etidronate therapy in r...
Báo cáo y học: "The role of statins as potential targets for bone formation" pptx
... 3-
hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reduc-
tase enzyme. These include naturally occurring lovastatin,
chemically modified simvastatin and pravastatin [1–3] and
the synthetically derived atorvastatin, ... Comparison, structure and organization of bone
and other mineralized tissues and the mechanism of calcifi-
cation. In: Handbook of physiology, endocrinolog...
Từ khóa:
- Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống
- chuyên đề điện xoay chiều theo dạng
- Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam
- Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz
- Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh
- Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh
- Phát hiện xâm nhập dựa trên thuật toán k means
- Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng
- Thơ nôm tứ tuyệt trào phúng hồ xuân hương
- Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX
- Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)
- BT Tieng anh 6 UNIT 2
- Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- chuong 1 tong quan quan tri rui ro
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật