Báo cáo y học: "Inverse association of plasma IL-13 and inflammatory chemokines with lung function impairment in stable COPD: a cross-sectional cohort study" doc

... ResearchOpen AccessResearchInverse association of plasma IL-13 and inflammatory chemokines with lung function impairment in stable COPD: a cross-sectional cohort studyJanet S Lee*1, Matthew ... in a COPD cohort is characterized by cytokines implicated in inflammatory cell recruitment and airway remodeling. Plasma concentrations of IL-13 and chemoattractants for monocytes, Tlymphocytes, ... concentrations of chemokines and IL-13 with increasing severity of disease, as measured by% FEV1 or % DLCO. Increasing severity of diffusion impairment is also associated with increasing G-CSF and decreasing...

Báo cáo y học: " Inverse association of natural mentoring relationship with distress mental health in children orphaned by AIDS" doc

... (SouthAfrica) and Kampala (Uganda), where the study was conducted for theirTable 2 ANOVA showing differences of having and not-having a natural mentor on mental health by orphan-typesOrphan-typesNo parents ... personsaged below 18 used. Local interviewers are Luganda(Ug anda) and Setswana/Afrikaans (South Africa) speak-ing research collaborators. The interviewer-administeredquestionnaire method is adopted ... each of which estimates the physi-cal, verbal, sexual, and labor dimensions of child abuse[38]: Are you - physically beaten in a manner you con-sider unfair; verbally abused in a manner y ou...

Báo cáo y học: "The association of meat intake and the risk of type 2 diabetes may be modified by body weight"

... data on associations between total meat and type of meat intake and the risk of type 2 DM are inconsistent and limited [3]. Total meat intake was associated with a higher risk of diabetes in ... 5 years and provided information on daily activity such as walking, stair climbing, cycling, household activities and daily commuting to and from work (walking and cycling). We calculated ... included in this analysis. For other participants the average of the baseline and follow-up FFQ data were used in the analyses. The average daily intake of individual food items (g/day) was combined...

Báo cáo y học: "The association of psychological stress and health related quality of life among patients with stroke and hypertension in Gaza Strip" pps

... 1Department of Psychiatry, School of Medicine, James Cook University, Australia, 2Department of Psychiatry and Psychotherapy, University of Munster, Germany and 3Islamic University, Gaza, Palestinian ... below in the manuscript. Thestudy was approved by the Ministry of Health in Gaza and the local ethical committee in Gaza Strip.Inclusion and exclusion criteriaAll available discharge data of patients ... Psy-chological stress was significantly correlated with the glo-bal domain only and income was significantly associated with the physical domain of QOL. Gender was signifi-cantly associated with quality...

Báo cáo y học: "The influence of serum, glucose and oxygen on intervertebral disc cell growth in vitro: implications for degenerative disc disease" potx

... HE, Ingram JA, Norton HJ, Hanley EN Jr: Senescence in cells of the aging and degenerating intervertebral disc: immu-nolocalization of senescence-associated beta-galactosidase in human and sand ... millilitre and a final alginate concentration of 1.2%. The alginate beadswere then incubated in combinations of medium supple-mented with or without serum and glucose and in 21% or 1%oxygen, as described ... were captured with a Hama-matsu (C4742-95; Hamamatsu Corporation, Bridgewater, NJ,USA) or Nikon digital camera and examined using IP Lab soft-ware (version 3.6; Nikon).Statistical analysisThe...

Báo cáo y học: "Sequence complementarity of U2 snRNA and U2A'''' intron predicts intron function" pptx

... >UGGCAGUACCUCCGGGCACGGUGCACCUCCCCCGGGAGGAAUGUGGCGUGGUGAAAGGAGAGAAGGAAGGCGGGGCGGUG Dr >UUGCAGUACUUCCGGGAACGGUGCACCCCCUAAUGAAGUUAACAAUAGAAUCCU Dr2 >UUGCAGUACUUCCGGGAACGGUGCACCCCCUAAUCAAGUUAAUGGAAGAUUAAAA ... >GCACCAUAUAUUAAAUUGAUUUUUGGAAUAGGGAGAUGGAAUAGGGGCUUGCUCCGUCCACUCCACGCAUCGACCCGGUA> Fr >GGACUAUAUAUUAAAUGCAUUUUUGCAGACAGGAGCUGAAACAGGAGCUUGCUCCAUUCACUCCACGCAUUGGCCCAGUA> Xl >GGACCAUAUAUUAAAUGGAUUUUUGGAACAGGGAGAUGGAAGAAGAGCUUGCUCUGUCCACUCCACGCAUCGACCUGGUA> ... U U G C–G C U A A–U U UUAAGUUGGA G–C A HsU2Ai5e6i6 A U A U |||||||||| G A A <1060-AACGAAGAGAAA–UAAGUUGGUCACAUCAUAGAAUAGA–U GACUAUGUUCUUGAGAGAG–CCACUUCAUCUCAAUUCAACCUAUA A A ||||||| | |...

báo cáo hóa học:" Increased vulnerability of rural children on antiretroviral therapy attending public health facilities in South Africa: a retrospective cohort study" docx

... hospitalsdue to the availability of paediatricians and related support and a shortage of clinicians at the primary healthcare level.Lack of pharmacy staff at decentralized facilities is also a barrier, ... providingrural ART in sub-Saharan Afr ica include a lack of healthpersonnel, lack of diagnostic facilities, difficulty and expense transporting medication to clinics, and a lack of staff training ... availability of immunologic and clinical status variables with mortality and LTFU wereassessed by considering missing values as a third categoryto the initially binary variable s. When comparing groups,the...

Báo cáo y học: "Biochemical markers of bone turnover and their association with bone marrow lesions" docx

... for all of thebiomarker assays in 150 participants. Upon merging thebiomarker assay data and MRI data, complete data (both com-plete biomarker and MRI data) were available for analysis in 144. ... standard deviation increase in the LnNTx, and with a small partial R2 of 3.05. We alsoevaluated 144 participants in the Framingham OsteoarthritisStudy, whose mean age was 68 years and body ... previous research, such as that showing the urinary excre-tion of pyridinium cross-links is significantly increased in patients with large joint OA and hand OA, suggesting anincreased rate of bone...

Báo cáo y học: "Negative association of the chemokine receptor CCR5 d32 polymorphism with systemic inflammatory response, extra-articular symptoms and joint erosion in rheumatoid arthritis" ppsx

... years of diseaseduration was analyzed (n = 158). In addition, in 118 patients, a radiograph taken after more than 10 years of disease dura-tion was available and was analyzed separately. In addition, ... hand and feet radiographs of thepatients. The presence of extra-articular manifestations of thedisease was judged by retrospective chart review and by anal-ysis of an available clinical database ... level at onset of disease as determined atinitial presentation with a rheumatologist was available foranalysis for the inception cohort of patients with early RA. Dataon extra-articular manifestations...

Báo cáo y học: "Unusual association of ST-T abnormalities, myocarditis and cardiomyopathy with H1N1 influenza in pregnancy: two case reports and review of the literature" pps

... T, Ayabe T,Kawagoe J, Matsuda J, Ishikawa T, Unoki T, Takenaga M, Fukunaga T,Nakagawa S, Koiwaya Y, Eto T: Clinical manifestations of influenza a myocarditis during the influenza epidemic of ... lack k nowledge regarding the safety and impor-tance of influenza vaccination during pregnancy. Mis-informed or inadequately informed health care workersmay represent a barrier to influenza ... reports and review of the literatureKaren Chan1, David Meek1 and Indranil Chakravorty1,2*AbstractIntroduction: Myocarditis is rarely reported as an extra-pulmonary manifestation of influenza...

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ