Báo cáo khoa học: "Calcification of the Intervertebral Discs and Curvature of the Radius and Ulna: A Radiographic Survey of Finnish Miniature" potx
Báo cáo khoa học: "Calcification of the Intervertebral Discs and Curvature of the Radius and Ulna: A Radiographic Survey of Finnish Miniature" potx
... 2001Calcification of the Intervertebral Discs and Curvature of the Radius and Ulna: A Radiographic Survey of Finnish Miniature DachshundsBy A. Lappalainen, M. Norrgård, K. Alm, M. Snellman and ... 2001Lappalainen A, Norrgård M, Alm K, Snellman M. Laitinen O: Calcification of the intervertebral discs and curvature of the radius and ulna: A radiographic survey of Finnish miniature dachshunds. Acta ... intervertebral discs in the dachshund: a radiographic study of 115 dogs at 1 and 5 years of age. Acta Vet. Scand. 1996, 37,229-237. Stigen O: Calcification of intervertebral discs in the dachshund: a radiographic...
- 8
- 303
- 0
Báo cáo khoa học: " Intraoperative radiotherapy (IORT) combined with external beam radiotherapy (EBRT) for soft-tissue sarcomas – a retrospective evaluation of the Homburg experience in the years 1995–2007" pdf
... planning of EBRT later. X-rays were taken nor-mally in anterior and lateral direction. The patient wastransferred to the radiotherapy room under anaesthesia, and radiotherapy was performed there ... evaluation of the patients' records, col-lection of the data, letters to the patients and the referringdoctors, and the entry of the data to the databank system.CR critically evaluated ... sarcomas, in the remaining nine the disease had recurred. The mean age at the beginning of treatment was 56 years, the meanKarnofsky performance status 92%. In the majority of cases the sarcomas...
- 6
- 334
- 0
báo cáo khoa học: " Part II, Provider perspectives: should patients be activated to request evidence-based medicine? a qualitative study of the VA project to implement diuretics (VAPID)" potx
... manuscript. MBW assisted with transcription and qualitative analysis and reviewed a draft of the manuscript. MVW and AJC contributed to the design of the study and reviewing and revising the manuscript. ... it was a number that I probably wasn’tawareof becausemaybetheywerefinethedayIsaw them and it did change my plan, you know,after seeing that.’ The intervention changed the provider’s approach ... asymptomatic disease. They have a rash on their elbow and a little ringing in theirear and they’ll often consume time just unloadingtheir frustrations. If, on the other hand, there was anincentive...
- 12
- 495
- 0
Báo cáo khoa học: "Within crown variation in hydraulic architecture in beech (Fagus sylvatica L): evidence for a stomatal control of xylem embolism" docx
... wasmeasured when flow became in a steady state and Kbranchwas calculated as the ratio between F and P:K = F / P. The LSC of the branch was calculated as the ratio be-tween Kbranch and the leaf ... calculated the fraction of inci-dent irradiance as the ratio between the irradiance mea-sured at a given place and irradiance above canopy. Wecompleted these data with measurements made duringsunny ... stomatalopening that induces transpiration is a necessary conse-quence of the plant’s need to maintain gas exchange inleaves for photosynthesis. To maintain a favourable wa-ter balance, an...
- 10
- 329
- 0
Báo cáo khoa học: "Gemcitabine/cisplatin versus 5-fluorouracil/ mitomycin C chemoradiotherapy in locally advanced pancreatic cancer: a retrospective analysis of 93 patients" pptx
... both arms, 91% of the patients hadan ECOG performance status of at least 2, respectively.All patients had ductal adenocarcinoma of the pancr easas diagnosed by biopsy or laparoscopically during ... for the adjuvant chemotherapy and prevented maintenance chemotherapy. Commonly, the combination of a fluoropy rimidine with radiotherapyis regarded to be the standard of care for CRT [4] but a substantial ... chemotherapy and ECOG perfor-mance status nor between additive chemotherapy and the type of chemoradiotherapy (GC vs FM). Patients withFM and GC had a median of 7 cycles of gemcitabine.Table...
- 8
- 437
- 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx
... 3¢-RACEZf3¢stat6-F2 CGGTAGTCAGGAAATCAATGCC 3¢-RACEZf5¢stat6-R1 CCATGTCTGCAGATGGTCGAGG 5¢-RACEZf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACEZf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACEZf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC ... CTGGATTGAAGCGCCCTCGGTTAATC 3¢-RACEZf5¢tbet-R1 GCTGCCTTTGTTATTTGTAAGCTTCAG 5¢-RACEZf5¢tbet-R2 GGAAACTTCCTGTCTCATCCAGTG 5¢-RACEZffoxp3-F1 GGAACACACAGAGGGGATGATA Initial PCRZffoxp3-R1 CTTCAACACGCACAAAGCAC Initial ... GTCCAGAATATTCAGCCTTTCACC 3¢-RACEZftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCRZftbet-R1 CACTGGATGAGACAGGAAGTT Initial PCRZf3¢tbet-F1 CTTCTCCAGGACAGTCCAAAGAGTC 3¢-RACEZf3¢tbet-F2 CTGGATTGAAGCGCCCTCGGTTAATC...
- 20
- 689
- 0
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx
... 710–728RpCAtrRq a TCA CAA ATG TCC AGT GCC AGT T 757–778Full-length sequencing of RpCAbrRpCAbrF TAC AAG GAT GCC ATT AGC 613–630RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839RpCAbrR2 AGA GCA GCA GAC CTT ACG 706–723RpCAbrR3 ... 706–723RpCAbrR3 GTT ACT TCC GCA GCT AGG 466–483Probe amplification for FISHRpCAbrF TAC AAG GAT GCC ATT AGC 613–630RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839RpCAtrFprobe TAC AAA GAT CCA ATC CAG C ... widespread in the Archaea and Bacteria domains[11]. Among the broad range of physiological processesin which they participate, CA can play a significantrole in autotrophic organisms, serving as an...
- 14
- 591
- 0
Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx
... AATGCTGGCTCTCCCTCGATGCTTGGCTACTGGACCATCAAHYPK GGAAATGGAAATAACAAGACAAATAGCGCGCAACTAATGCTTCCACAAHSP70 TGACCAAGGCAACAGAACCAAATCAGACGGCCGGTATGTGHeat shock 70 kDa protein 1 2A CGAAAAAGGACAGCAGTTGAAACTCATCCTCCACCGGATTGTHSP23 ... kinasecomplex-associated proteinAAAGCAGAGCAGAAAAAGTGGAAGGACAATGCCGCGATCAGNon-selenium glutathione peroxidase CAATGAACAAAAAAGTCGCAACAGGGATGGAGGGTAAGACCATACAGlutamine synthetase ACGGAGGTTGACGGGACTTGCTGGCACCACGATTGGDelta-9-desaturase ... CGTCCGATTTCTTCTCGTGTTTACCAGAAGACATTACAGTGAAAATTGAChaperonin-containing TCP1, subunit 7, isoform b, isoform 1 GGGAACCAGCAGTCGTCAAACGTCCACTGAGAGGATGAGACAInhibitor of kappa light polypeptide enhancer...
- 11
- 570
- 0
Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt
... nitrocellulosefilters, as described in the Materials and methods. (A) Western blot-ting. The filter was assayed using anti-eEF 1A mAb, as described in the Materials and methods. The position of the eEF 1A protein was ... rinsed and thenexposed to Omat XAR Kodak film, as described in the Materials and methods. The same samples were used for Western blotting analysisperformed with the same amount of the cytoplasm and ... were analysed foreEF 1A and b-actin content.Fig. 8. Bidimensional PAGE analysis of nuclear elongation factor 1alpha (eEF 1A) . (A) Thirty micrograms of nuclear extracts from CCRFCEM cells and...
- 12
- 552
- 0
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf
... animal glycoconjugate. They actas an important component of the ligands recognized by the lectins. Recognition can be affected by specific structuralvariations and modifications of sialic acids and ... contain4-O-Ac-NeuAc [43], and rabbit erythrocytes, which contain9-O-Ac-NeuAc [41], showed maximum haemagglutination.On the other hand, human blood cells A, B and O [44,45], and sheep have ... Palatty, N. Renuka Bai and S. Jeya SuriyaDepartment of Zoology, Holy Cross College, Rochnagar, Nagercoil Tamil Nadu, India A naturally occurring hemagglutinin was detected in the serum of the...
- 8
- 616
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ