Báo cáo y học: " Membrane diffusion- and capillary blood volume measurements are not useful as screening tools for pulmonary arterial hypertension in systemic sclerosis: a case control study" pptx
Báo cáo y học: " Membrane diffusion- and capillary blood volume measurements are not useful as screening tools for pulmonary arterial hypertension in systemic sclerosis: a case control study" pptx
... a decrease in capillary flow and thus a decrease in Vc. Thiswill result in a reduction in surface area available for gasexchange, and therefore in a decrease of Dm [25]. Sec-ondly, parenchymal and ... tompography; IPAH: idiopathic pulmonary arterial hypertension; PAH: pulmonary arterial hypertension; Ppa: pulmonary artery pressure; PCWP: pulmonary capil-lary wedge pressure; SSc: systemic ... alveolar capillary membrane as percentage of predicted (Vc%/Dm%) and the pulmonary vascular resistance (PVR) and the mean pulmonary artery pressure (mPpa) in patients with systemic sclerosis-associated...
- 8
- 264
- 0
Báo cáo y học: "Sequencing the genome of the Burmese python (Python molurus bivittatus) as a model for studying extreme adaptations in snakes" ppsx
... contractile performance and metabolic capacity in a high-frequency muscle. Physiol Biochem Zool 2006, 79:20-30.13. Matsubara K, Tarui H, Toriba M, Yamada K, Nishida-Umehara C, Agata K, Matsuda Y: Evidence ... mechanisms that underlie regu-lation of organ performance and regeneration. ese animals are also readily obtained from commercial breeders, non-aggressive, and easier and cheaper to care for ... physiological changes, including: a 44-fold increase in metabolic rate (the highest among tetrapods); 35 to 100% increases in the mass of the heart, liver, pancreas, small intestine, and...
- 8
- 410
- 0
Báo cáo y học: "Membrane transporters and protein traffic networks differentially affecting metal tolerance: a genomic phenotyping study in yeas" potx
... Chang A: An endosome-to-plasma membrane path-way involved in trafficking of a mutant plasma membrane ATPase in yeast. Mol Biol Cell 2000, 11:579-592.89. Nothwehr SF, Ha SA, Bruinsma P: Sorting ... 5'-(CGCGGACCGTTAACTGATATCACCATGAGACATG)-3'SMF2 Forward 5'-(CGCGGTCCGCTACGTAGCCACCATGACGTCCCAAGAATATGAACC)-3'SMF2 Reverse 5'-(CGCGGACCGTTAGAGGTGTACTTCTTTGCCCG)-3'SMP1 Forward ... chromatin modification complexes SAGA and INO80,plus the histone deacetylase HDA1. Proteins involved in his-tone acetylation may affect metal tolerance by influencingDNA reactivity as well as...
- 19
- 252
- 0
Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot
... the agents now in use.This treatment is especially promising in autoimmune dis-eases characterized by a relapsing and remitting coursesuch as SLE, inflammatory bowel disease or certain formsof ... circulating myelin basic protein and proteolipid protein-specific transforming growth factor-beta1-secreting Th3 T cells by oral administration of myelin in multi-ple sclerosis patients. J Clin Invest ... TGF-β has well-known inhibitory effects on lympho-cyte cytokine production and functional properties [35],our laboratory has accumulated data that these effectscan be overcome by IL-2 and can...
- 6
- 408
- 0
Báo cáo y học: " Brain size and brain/intracranial volume ratio in major mental illness" doc
... bone and tissue external to this boundary wasstripped leaving ICV containing brain and CSF for thatslice. Next the estimate of CSF - brain boundary wasexamined and corrected visually by hand as ... determined all intracranial and brain volumes over the total c ourse of the study.Formal training in brain volume identification includingaccurate delineation of the skull -CSF boundary was pro-vided ... theTable 2 Means and standard deviations (SD) for intracranial volume (ICV), total brain volume (TBV), ventricular volume (VV), ventricle/brain ratio (VBR), and brain volume/ intracranial volume...
- 9
- 385
- 0
Báo cáo y học: "Natural history and clinical significance of MRI-detected bone marrow lesions at the knee: a prospective study in community dwelling older adults" pot
... designed and carried out the study planning,participated in analysis and interpretation of the data, and critically revisedthe manuscript. All authors have read and approved the final manuscript.Dore ... properly cited.variation in study designs. We assessed BMLs by mea-suring the maximal area at baseline and follow-up. Wethen calculated whether there was an actual change in BML size from baseline ... 25% decreased in size and 24% increased. Of theremaining sample (n = 227), 7% developed a new BML. In a multivariable model, a change in BML size wasassociated with a change in pain and function...
- 12
- 333
- 0
Báo cáo y học: " Proviral integrations and expression of endogenous Avian leucosis virus during long term selection for high and low body weight in two chicken lines" ppt
... ReverseBeta-actinF/Beta-actinR - AGGTCATCACCATTGGCAATG CCCAAGAAAGATGGCTGGAAGAPDHF/GAPDHR - GGGAAGCTTACTGGAATGGCT GGCAGGTCAGGTCAACAACAPOMCF/POMCR - GCTACGGCGGCTTCATGA CGATGGCGTTTTTGAACAGAGPMCHF/PMCHR - CGAAATGGAGACGGAACTGAA ... CGAAATGGAGACGGAACTGAA CATCCAAGAAGCTTTCCTCAATCTVal_envF/Val_envR b* ACCCGGACATCACCCAAAG AGTCAGAAATGCCTGCAAAAAGAchENV232fwd/chENV1046rev e* ACGGATTTCTGCCTCTCTACACA TTCCTTGCCATGCGCGATCCCqPCR_envF/qPCR_envR ... d* GAAACTACCTTGTGTGCTGTCG CGGATGTTGTGGAAAAACGAenv277F/env353R c* CCCAAAATCTGTAGCCATATGC TACGGTGGTGACAGCGGATAGGpol197F/pol269R a* TGCTTGTCTCCCCAGGGTAT GGTGACTAAGAAAGATGAGGCGARetrovirology 2009,...
- 13
- 284
- 0
Báo cáo y học: "Alcohol intoxication and mental health among adolescents – a population review of 8983 young people, 13–19 years in North-Trøndelag, Norway: the Young-HUNT Study" pot
... research, statistical analysis, drafting and presentation. NB was essential in the development of theidea, description and thinking of the study, as well as drafting of the article. All authors ... measure. More than 10intoxications were defined as high alcohol use in all agegroups. The same definition has been used in previousstudies and is known to be easy to collect, fairly stable and easily ... adolescence.Competing interestsThe authors declare that they have no competing interests.Authors' contributions AS participated in designing the study, performed theanalysis and drafted the article....
- 7
- 265
- 0
Tài liệu Báo cáo khoa học: The diacylglycerol and protein kinase C pathways are not involved in insulin signalling in primary rat hepatocytes doc
... protein activates the ras/mitogen-activated protein kinase pathway and (b)phosphatidylinositol 3-kinase activates the protein kin-ase B/glycogen synthase kinase-3 cascade. Recent datasuggest ... extracted with ether and immediately benzoylated, as described by Blank et al. [32]. Diradylglycerobenzoates wereseparated into their subclasses (diacyl, alkylacyl, and alk-1-enylacyl types) by ... Bandyopadhyay, G.& Farese, R.V. (1996) The phosphatidylinositol 3-kinase inhibitor,wortmannin, inhibits insulin-induced activation of phosphati-dylcholine hydrolysis and associated protein...
- 12
- 592
- 0
Báo cáo sinh học: " The Israeli strain IS-98-ST1 of West Nile virus as viral model for West Nile encephalitis in the Old World" pdf
... serum and a FITC-conjugated second-ary antibody, green staining) and neuronal specific enolase (using a rabbit polyclonal antiserum and an anti-rabbit polyclonal antibody made in goat conjugated ... from tropicalAfrica and Madagascar island) and the lineage I (tropicalafrican strains) that caused the outbreaks of WNV infec-tion in North Africa, Europe, Israel, and in the UnitedStates. Nucleotide ... group): intraperitoneal (i.p.), intradermal(i.d.), intracerebral (i.c.), and intranasal (i.n.). At Days 5 and 7 of infection, three animals per group were eutha-nasied; brain and spinal cord...
- 5
- 403
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015