0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: " Co-expression and promoter content analyses assign a role in biotic and abiotic stress responses to plant natriuretic peptides" pptx

báo cáo khoa học:

báo cáo khoa học: " Co-expression and promoter content analyses assign a role in biotic and abiotic stress responses to plant natriuretic peptides" pptx

... and promoter content analyses assign a role in biotic and abiotic stress responses to plant natriuretic peptidesStuart Meier1,3, René Bastian1, Lara Donaldson2, Shane Murray1, Vladimir ... predict a function for AtPNP -A in plant abiotic and biotic stress responses, and in particular in systemicacquired resistance (SAR). Furthermore, we demonstratehow computational analyses that link ... Sayed M, Wherrett T, Shabala S, Gehring C: A recombinant plant natriuretic peptide causes rapid and spa-tially differentiated K+, Na+ and H+ flux changes in Arabi-dopsis thaliana roots. Plant...
  • 12
  • 396
  • 0
Báo cáo y học:

Báo cáo y học: "Synthetic rabbit-human antibody conjugate as a control in immunoassays for immunoglobulin M specific to hepatitis E virus" ppsx

... for Clinical Laborato-ries.Author DetailsNational Center for Clinical Laboratories, Beijing Hospital, Beijing, PR ChinaReferences1. Balayan MS, Andjaparidze AG, Savinskaya SS, Ketiladze ES, ... of analytical results in the medical laboratory. Eur J Clin Chem Clin Biochem 1996, 34:983-999.13. Koshy A, Grover S, Hyams KC, Shabrawy MA, Pacsa A, al-Nakib B, Zaidi SA, al-Anezi AA, al-Mufti ... containing 1% bovine serum albumin (BSA) and 10 mM histidine. After incubation at 20°C, 4°C, 37°C, and room temperature for 0, 1, 2, 4, and 8 weeks, samples were removed at each time point and analyzed...
  • 5
  • 311
  • 0
Báo cáo khoa học: Stimulation of fibroblast proliferation by neokyotorphin requires Ca2+ influx and activation of PKA, CaMK II and MAPK/ERK pdf

Báo cáo khoa học: Stimulation of fibroblast proliferation by neokyotorphin requires Ca2+ influx and activation of PKA, CaMK II and MAPK/ERK pdf

... mutationswithin the B-Raf glycine-rich loop in colorectaltumors on mitogen-activated protein ⁄ extracellularsignal-regulated kinase kinase ⁄ extracellular signal-regulated kinase and nuclear factor kappaB ... II;CREB, cAMP-response element binding protein; ERK, extracellular signal-regulated protein kinase; MAPK, mitogen-activated protein kinase;MSK1, mitogen and stress- activated protein kinase 1; PKA, ... Stimulation of fibroblast proliferation by neokyotorphinrequires Ca2+ in ux and activation of PKA, CaMK II and MAPK/ERKOlga V. Sazonova, Elena Yu. Blishchenko, Anna G. Tolmazova, Dmitry P. Khachin,Konstantin...
  • 11
  • 726
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Japanese Named Entity Recognition based on a Simple Rule Generator and Decision Tree Learning" pdf

... training data. For in- stance, a morphological analyzer may divide a four-character expression OO-SAKA-SHI-NAIinto two words OO-SAKA (= Osaka) and SHI-NAI (= in the city), but the training data ... .According to this ordering, two candidates canhave the same rank. One of them might assert that a certain word is an organization’s name and an-other candidate might assert that it is a person’sname. ... charac-ters are used in Japanese: hiragana, katakana,kanji, symbols, numbers, and letters of the Ro-man alphabet. We use 17 character types forwords, e.g., single-kanji, all-kanji,all-katakana,...
  • 8
  • 530
  • 0
Báo cáo khoa học: Three novel carp CXC chemokines are expressed early in ontogeny and at nonimmune sites ppt

Báo cáo khoa học: Three novel carp CXC chemokines are expressed early in ontogeny and at nonimmune sites ppt

... CGGGACGGTGTTGAGAGTGGACXCL12.rv5 GAGAGTGGACCGGCACCAACAqCXCL12b.fw1 GAGGAGGACCACCATGCATCTqCXCL12b.rv1 TTGTGCAAGCAGTCCAGAAAGACarp CXCL14 AJ536028 CXCL14.rv3 GGATGCAGGCAATACTCCTGCXCL14.fw5 CCATACTGCCAAGAAAAGATGATqCXCL14.fw1 ... CAACAGGGAAAAGATGACACAGATCqACT.rv1 GGGACAGCACAGCCTGGATVector T7 TAATACGACTCACTATAGGGT3 CGCAATTAACCCTCACTAAAGÓ FEBS 2004 Three novel carp CXC chemokines (Eur. J. Biochem. 271) 4095phagocytes ... CACCGTCACAGATATGTACCATATAGTCqCXCL1 2a. rv1 GGTGGTCTTTTGCAGAGTCATTTCarp CXCL12b AJ536027 CXCL12.rv1 TTCTTTAGATACTGCTGAAGCCACXCL12.fw3 AGGTCTGCATCAACCCCAAGCXCL12.fw4 GCATCAACCCCAAGACCAAATGGCXCL12.rv4 CGGGACGGTGTTGAGAGTGGACXCL12.rv5...
  • 13
  • 398
  • 0
Báo cáo khoa học: The HNF1b transcription factor has several domains involved in nephrogenesis and partially rescues Pax8/lim1-induced kidney malformations docx

Báo cáo khoa học: The HNF1b transcription factor has several domains involved in nephrogenesis and partially rescues Pax8/lim1-induced kidney malformations docx

... 5¢-CGAGAGGTGGCGCAGCAGTTCAACCAGACAGTCCAG-3¢(forward), 5¢-GCCGCTCTAGATTAGCGCACTC-3¢ (re-verse); HNF1aaains26: 5¢-CGAGAGGTGGCGCAGCAGTTCAACCAGACAGTCCAG-3¢ (forwa rd), 5¢-CTCCCTGCCCTGCATGGGTGAACTCTGGAAAGAGAAAC-3¢ (reverse).3HNF1aabH and ... sequence using the followingprimers: HNF1aab: 5¢-GATGAGCTACCAACCAAGAAGATGCGCCGCA-3¢ (forward), 5 ¢-GCCGCTCTAGATTAGCGCACTC-3¢ (reverse); HNF1aabins26: 5¢-CGAGAGGTGGCGCAGCAGTTCAACCAGACAGTCCAG-3¢(forward), ... truncated HNF1b proteinsretaining t he DNA binding domain (e.g. Y352insA) as wellas a HNF1b mutant with an in- frame internal deletion in the POUSdomain (R137–K161) that destroys DNAbinding...
  • 14
  • 245
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Parsing the Wall Street Journal using a Lexical-Functional Grammar and Discriminative Estimation Techniques" doc

... Journal using a Lexical-Functional Grammar and Discriminative Estimation TechniquesStefan Riezler Tracy H. King Ronald M. KaplanPalo Alto Research Center Palo Alto Research Center Palo Alto Research ... ofConstraint-Based Grammars using Log-Linear Mea-sures and EM Training. In Proceedings of the 38thAnnual Meeting of the Association for ComputationalLinguistics (ACL’00), Hong Kong.Parsing the Wall ... Grammar (LFG) and a constraint-based parser with partial parsing tech-niques. In the absence of a complete parse, a so-called “FRAGMENT grammar” allows the input to beanalyzed as a sequence of...
  • 8
  • 477
  • 0
Báo cáo khoa học: High-resolution crystal structures of the flavoprotein NrdI in oxidized and reduced states – an unusual flavodoxin pot

Báo cáo khoa học: High-resolution crystal structures of the flavoprotein NrdI in oxidized and reduced states – an unusual flavodoxin pot

... with apoflavodoxin: a sensitive assay for riboflavin5¢-phosphate and flavin adenine dinucleotide in mix-tures. Anal Biochem 68, 609–616.R. Johansson et al. NrdI – an unusual flavodoxinFEBS Journal ... FMN cofac-tor and the 40s loop. Residues within 4 A ˚of FMN that makeinteractions with it are shown as thin lines. Particularly relevantside chains, including all acidic side chains in the ... difference map peak is approximately 4 r. A marker atom has been placed in theelectron density to show the distances to potential coordinating atoms in the vicinity. Prepared usingPYMOL.NrdI – an unusual...
  • 13
  • 422
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Early clinical experience with volumetric modulated arc therapy in head and neck cancer patients" ppsx

... data of Group A and Bwere analyzed together; presenting irradiation of similaranatomical regions, while Group C was kept separatedinvolving the sinonasal region only, and not the neckareas.Technical ... Switzerland.Authors’ contributionsMS and AF coordinated the entire study. Patient accrual and clinical datacollection was done by MS, SC, CB, MB, PN, SP. Data analysis, physics data and treatment ... ParanasalSinusesOther731611062Histology Squamous cell carcinomaDifferentiated carcinomaUndifferentiated carcinomaAdenoidocistic carcinomaEstesioneuroblastomaSarcomas3412332Sex MalesFemales2817AgePerformance...
  • 10
  • 380
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "The alkylphospholipid, perifosine, radiosensitizes prostate cancer cells both in vitro and in vivo" docx

... perifosine and the colony formation assaywas conducted. Shown are the means and standard deviation of eachindividual treatment points. Figure S2: Perifosine and radiation inducedapoptosis in PC-3 ... Guangzhou,China.6Department of Radiology and Radiation Oncology, Kitasato UniversitySchool of Medicine, Sagamihara, Kanagawa, Japan.7Cancer Hospital, ChineseAcademy of Medical Sciences and Peking Union Medical College, ... Bellacosa A, de Feo D, Godwin AK, Bell DW, Cheng JQ, Altomare DA,Wan M, Dubeau L, Scambia G, Masciullo V, et al: Molecular alterations ofthe AKT2 oncogene in ovarian and breast carcinomas. Int...
  • 8
  • 306
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP