0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: " Analysis of rice glycosyl hydrolase family 1 and expression of Os4bglu12 β-glucosidase" potx

Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): reactivity and structure of metal–thiolate clusters* doc

Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): reactivity and structure of metal–thiolate clusters* doc

... to original French government works MINIREVIEW Neuronal growth-inhibitory factor (metallothionein-3): reactivity and structure of metal–thiolate clusters* Peter Faller1,21 CNRS, LCC (Laboratoire ... is a soft ligand and therefore shows a preference for soft metals. More-over the structures of metallothioneins are not rigid and hence there is little selectivity concerning the size of the ... determination of the spatial structure of the N-terminal domain con-taining the Cd(II)3-CysS9cluster was thus precluded.For a more detailed discussion of the dynamics of theprotein structure and...
  • 10
  • 569
  • 0
Tài liệu Báo cáo khoa học: Poly(silicate)-metabolizing silicatein in siliceous spicules and silicasomes of demosponges comprises dual enzymatic activities (silica polymerase and silica esterase) doc

Tài liệu Báo cáo khoa học: Poly(silicate)-metabolizing silicatein in siliceous spicules and silicasomes of demosponges comprises dual enzymatic activities (silica polymerase and silica esterase) doc

... Poly(silicate)-metabolizing silicatein in siliceous spicules and silicasomes of demosponges comprises dual enzymatic activities (silica polymerase and silica esterase) Werner ... tetrahedral silica units in poly(silicate)is an ester-like bond. In order to test whether silicatein in addition to being a poly(silicate)-forming enzyme (silica polymerase) – also functions as an silica ... 2007)doi:10.1111/j.1742-4658.2007.06206.x Siliceous sponges can synthesize poly(silicate) for their spicules enzymati-cally using silicatein. We found that silicatein exists in silica- filled cellorganelles (silicasomes) ...
  • 9
  • 576
  • 0
Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt

Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt

... and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria Raka Ghosh, Sibani Chakraborty, Chandana Chakrabarti, Jiban Kanti Dattagupta and Sampa ... Chakraborty S, Biswas S, Chakrabarti C &Dattagupta JK (2005) Crystallization and preliminaryX-ray diffraction studies of the cysteine protease erva-tamin A from Ervatamia coronaria. Acta ... S, Sundd M, Jagan-nadham MV & Dattagupta JK (1999) Crystallization and preliminary X-ray analysis of ervatamin B and C,two thiol proteases from Ervatamia coronaria. ActaCrystallogr D 55,...
  • 14
  • 634
  • 0
Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx

Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx

... details about the role of different resi-dues of the aglycone-binding site in the stabilization of ESà and the interdependence between the binding of aglycone and the positioning of glycone in ... (dimboa-Glc) was included to facilitate the visualization of the active site. (C) Agly-cone-binding site of SbDhr1, including the substrate dhurrin. (D) Aglycone-binding site of BglB, including the ... 5Â-gagagatttgctttgcgggttatggatctgc-3Â; mutation K20 1A, 5Â-gttatggatctgctaccgcggctccgatcctaaacg-3Â; mutation K201F, 5Â-ggttatggatctgctacttcgctccgatcctaaacgc-3Â; and mutation M45 3A, 5Â-ggacaactttgaatgggcggagggttatattgag-3Â....
  • 12
  • 731
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Collecting a Why-question corpus for development and evaluation of an automatic QA-system" pdf

... problem of several possible answers and, inconsequence, automatic evaluation has been tackled for years within another field of study: automatic summarisation (Hori et al., 2003; Lin and Hovy,2003). ... definition of what is a correct answer, and a way to com-pare the correct answers to automatic answersproduced by a system. For this purpose wepresent a Wikipedia-based corpus of Why-questions and ... evaluation: manual evaluation is a difficult, time-consuming process and not ap-plicable within efficient development of sys-tems. Automatic evaluation requires a cor-pus of questions and answers, a definition...
  • 9
  • 610
  • 1
Tài liệu Báo cáo khoa học: Phenol hydroxylase from Acinetobacter radioresistens S13 Isolation and characterization of the regulatory component docx

Tài liệu Báo cáo khoa học: Phenol hydroxylase from Acinetobacter radioresistens S13 Isolation and characterization of the regulatory component docx

... reports the isolation and characterization of the regulatory moiety of the multicomponent enzyme phenol hydroxylase from Acinetobacter radioresistens S13 grown on phenol as the only carbon and energy ... radioresistens S13 phenol hydroxylase regulatory component (Eur. J. Biochem. 270) 1437 Phenol hydroxylase from Acinetobacter radioresistens S13 Isolation and characterization of the regulatory component Ersilia ... and in alkene monooxygenase from Nocardia corallina [8].In phenol hydroxylase of A. radioresistens S13, the third component is needed for the overall enzyme activity; in phenol hydroxylase from...
  • 7
  • 514
  • 0
Báo cáo khoa học: Protein transport in organelles: The composition, function and regulation of the Tic complex in chloroplast protein import pptx

Báo cáo khoa học: Protein transport in organelles: The composition, function and regulation of the Tic complex in chloroplast protein import pptx

... stabilization of the Toc /Tic/ preprotein supercomplex. In this model, Tic1 10 forms the channel protein and also acts in the recruitment of Hsp93 in concertwith the co-chaperone Tic4 0. The TPR domain of Tic4 0 ... 1175 MINIREVIEW Protein transport in organelles: The composition, function and regulation of the Tic complex in chloroplast protein import J. Philipp Benz1,2,Juărgen Soll1,2 and Bettina Boălter1,21 ... patch on the protein surface, located in the N-terminal half of the protein, including the dehydrogenase domain. Spe-cific binding of the FNR is mediated by a unique series of proline/serine-rich...
  • 11
  • 491
  • 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... (Paris,France): 5forGulox (forward), 5Â-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGATGACGACGACAAGATGAGCCCGATATGGAGTAATTGGCCT-3Â; and 3rev-Gulox (reverse), 5Â-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A- 3Â. ... Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase Beata A. Wolucka1and David Communi21 Laboratory of Mycobacterial Biochemistry, ... (l-ascorbic acid; L-AA) is an importantmetabolite of plants and animals. It functions as anantioxidant (or pro-oxidant), an enzyme cofactor, aneffector of gene expression, and a modulator of react-ive...
  • 11
  • 571
  • 0
Báo cáo khóa học: Surface nucleolin participates in both the binding and endocytosis of lactoferrin in target cells potx

Báo cáo khóa học: Surface nucleolin participates in both the binding and endocytosis of lactoferrin in target cells potx

... Location of nucleolin- binding sites in both lobes, but not in the basic N-terminus of lactoferrin. (A) Schematic linear representation of the human lactoferrin (hLf) derivatives used in binding competition ... biologicalfunctions of Lf are relevant to this binding. Some of theseFig. 10. Prediction of nucleolin- binding sites in human lactoferrin (hLf).Sequences of the N2 and C2 domains of hLf, bovine lactoferrin (bLf) and ... for the binding of hLfto surface nucleolin. We have previously shown that the specific binding of HB-19 to surface nucleolin occursthrough the arginine-rich basic C-terminal tail of nucleolin [26]....
  • 15
  • 509
  • 0
Báo cáo khoa học: Enzymatic toxins from snake venom: structural characterization and mechanism of catalysis ppt

Báo cáo khoa học: Enzymatic toxins from snake venom: structural characterization and mechanism of catalysis ppt

... REVIEW ARTICLE Enzymatic toxins from snake venom: structural characterization and mechanism of catalysis Tse Siang Kang1, Dessislava Georgieva2, Nikolay ... involving the side chains of Lys and Asp49 while the C-terminal carboxyl group of peptide interacts with the side chain of His48 of the protein. Enzymatic toxins from snake venom T. S. Kang et ... potentially of the role of AChE in snake venom. Mechanism of catalysis The structure of AChE is remarkably similar to serinehydrolases and lipases. It belongs to the a ⁄ b hydrolasefamily, one of the...
  • 33
  • 436
  • 0
Báo cáo khoa học: UDP-galactose 4-epimerase from Kluyveromyces fragilis – catalytic sites of the homodimeric enzyme are functional and regulated docx

Báo cáo khoa học: UDP-galactose 4-epimerase from Kluyveromyces fragilis – catalytic sites of the homodimeric enzyme are functional and regulated docx

... that the catalytic sites of the enzyme are functional and are distinguishable on the basis of bind-ing with the inhibitor. Careful analysis of Fig. 2 showsthat inactivation of E3by trypsin and ... Council of Scientic and Industrial Research, New Delhi. Journal compilation ê 2009 FEBS 6727 UDP-galactose 4-epimerase from Kluyveromyces fragilis catalytic sites of the homodimeric enzyme are functional ... inactivation by 50% in thesereactions indicated that the catalytic sites of epimerase are nonidentical.Equation (2) was used further to assess the perfor-mance of the catalytic sites of the inhibitor-free...
  • 16
  • 580
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Using Conditional Random Fields to Extract Contexts and Answers of Questions from Online Forums" docx

... of ACL-08: HLT, pages 710–718,Columbus, Ohio, USA, June 2008.c2008 Association for Computational LinguisticsUsing Conditional Random Fields to Extract Contexts and Answers of Questions from ... Con-ditional Random Fields (CRFs) to detect the contexts and answers of questions from forumthreads. We improve the basic framework bySkip-chain CRFs and 2D CRFs to better ac-commodate the features of ... distancedependency between contexts and answers. One straightforward method of leveraging contextis to detect contexts and answers in two phases, i.e. to first identify contexts, and then label answers us-ing...
  • 9
  • 605
  • 0
Báo cáo khoa học: Heme binding to the second, lower-affinity site of the global iron regulator Irr from Rhizobium leguminosarum promotes oligomerization potx

Báo cáo khoa học: Heme binding to the second, lower-affinity site of the global iron regulator Irr from Rhizobium leguminosarum promotes oligomerization potx

... 2011–2021 ª 2011 The Authors Journal compilation ª 2011 FEBS Heme binding to the second, lower-affinity site of the global iron regulator Irr from Rhizobium leguminosarum promotes oligomerization Gaye ... of heme binding to Irr from B. japoni-cum indicated that the protein has both ferric and fer-rous heme- binding sites [12]. To investigate whether Irr Rlhas a specific ferrous heme- binding site, ... insights into the mecha-nisms and consequences of heme binding to Irr. In addition to the HxHmotif, Irr binds heme at a second, lower-affinity site. Spectroscopic studies of wild-type Irr and His...
  • 11
  • 281
  • 0
Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot

Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot

... gene and 3Â end of a signal peptide: 5Â-CAGAAGCGGAAGAAAGCATGCAAAGGCAGA-3Â (number 2), wereused. In the second PCR the plasmid pFastBacPx was usedas a template with upstream and downstream primerscontaining, ... the N-terminal fragment of the poneratoxin gene. Two others: forward 5Â-GCCGCCCGTGATACAGGCGATCCACGATGCGCAGAGGTAGTAATGAG-3Â and reverse 5Â-AATTCTCATTACTACCTCTGCGCATCGTGGATCGCCTGTATCACGGG-3Â ... construction of the poneratoxin gene [11]. Two oligonucleotides: forward5Â-2GATCCATGTTTCTTCCGCTTCTGATCCTTGGCTCTCTTCTGATGAC-3Â and reverse 5Â-CGGCGTCATCAGAAGAGAGCCAAGGATCAGAAGCGGAAGAAACATG-3Â,...
  • 10
  • 696
  • 0
báo cáo khoa học:

báo cáo khoa học: " Analysis of rice glycosyl hydrolase family 1 and expression of Os4bglu12 β-glucosidase" potx

... 02 016 859 (F) 02 017 035 (F)AC1 213 66 (F) AC137 618 (F) AP008 211 (F) AP008 211 /17 403620 bp -17 407871bp/chr 5 1 AK120998 (F?) 0Os5bglu 21 02 016 862 (F) AC1 213 66 (F) AC137 618 (F) AP008 211 (F) AP008 211 /17 4 217 99 ... AP008 211 /17 4 217 99 bp -17 427364 bp/chr 5 1- 0Os5bglu22 02 016 869 (F) 02 016 867 (aa 1 61) AC1 213 66 (F) AC137 618 (F) (AAV 313 58) AP008 211 (F)AP008 211 /17 450999 bp -17 456 012 bp/chr 5 1 AK0 714 69 ... has stop after aa 434Os12bglu38 0203 419 8 (F) 0203 419 7 (aa 1 11 3)AL7 317 85 (F) AL7323 81 (F) AP008 218 (F) AP008 218 /13 144002 bp -13 146 818 bp/chr 12 2 AK0 710 58 (F) 11 sh, sp, pn-FW, pn-FW-DrOsbglu39...
  • 19
  • 269
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP