Báo cáo khoa học: "Verification of the Combimatrix influenza detection assay for the detection of influenza A subtype during the 2007–2008 influenza season in Toronto, Canada" pot
Báo cáo khoa học: "Image guidance using 3D-ultrasound (3D-US) for daily positioning of lumpectomy cavity for boost irradiation" pptx
... conceived of the study, and participated in its design andcoordination. AY participated in the coordination and statistical analysis. CGand RM performed data acquisition on all images and contributed ... that has infrared reflective markersaffixed to its handle. The markers are tracked by an infra-red camera to determine the position and orientation of each ultrasound frame. The frames are then ... Shenouda G, Souhami L, et al: Ultrasound-based image guidedradiotherapy for prostate cancer: comparison of cross-modality andintramodality methods for daily localization during external beamradiotherapy....
- 11
- 270
- 0
báo cáo khoa học: "New clinical developments in histone deacetylase inhibitors for epigenetic therapy of cancer" doc
... MusguireLA, Stoller RG, et al.: Phase I and pharmacokinetic study of vorinostat, a histone deacetylase inhibitor, in combinationwith carboplatin and paclitaxel for advanced solid malignan-cies. Clin ... 2005,104:2717-2725.92. Chavez-Blanco A, Segura-Pacheco B, Perez-Cardenas E, Taja-ChayebL, Cetina L, Candelaria M, et al.: Histone acetylation and histonedeacetylase activity of magnesium valproate in tumor andperipheral ... Covens A, MacAlpine K, Wang L, Tsao MS, etal.: A phase II trial of the histone deacetylase inhibitor belino-stat (PXD101) in patients with platinum resistant epithelialovarian tumors and micropapillary/borderline...
- 11
- 403
- 0
Báo cáo khoa học: "Drotrecogin alfa (activated): current evidence supports treatment for severe sepsis patients with a high risk of death" ppsx
... 344:699-709.3. Abraham E, Laterre PF, Garg R, Levy H, Talwar D, Trzaskoma BL,Francois B, Guy JS, Bruckmann M, Rea-Neto A, et al., for the Administration of Drotrecogin alfa (activated) in Early StageSevere ... estimateto the left of the line of identity (1) favors treatment with Drotrecogin alfa (activated) and an estimate to the right favors placebo. A 95% confidenceinterval (CI) is included for each ... 1Meta-analysis of PROWESS and ADDRESS patients with APACHE II score (AP) ≥ 25 using output from standard meta-analysis software (ReviewManager, Version 4.2). The results from the following three...
- 2
- 211
- 0
báo cáo khoa học: "Combined mirror visual and auditory feedback therapy for upper limb phantom pain: a case report" docx
... participated in data collection, casewriting and critical review of the manuscript. All have read and approved the final manuscript.Competing interests The authors declare that they have no competing ... sensoryand visual feedback. In an amputee there is no verifica-tion, resulting in a c onflict between the incoming andoutgoing of information to the cortex. Interestingly,there is data showing ... sensation and phantom limb pain is a very common issue after amputations. In recent years there has been accumulating data implicating ‘mirror visual feedback’ or ‘mirror therapy’ as helpful in the...
- 4
- 376
- 0
Báo cáo khoa học: "Verification of the Combimatrix influenza detection assay for the detection of influenza A subtype during the 2007–2008 influenza season in Toronto, Canada" pot
... limited molecular capabilities.FindingsClassification of seasonal influenza A into H3N2 or H1N1subtypes is an important step in the characterization of circulating influenza A strains. The recent ... influenza detection assay for the detection of influenza A subtype during the 2007–2008 influenza season in Toronto, CanadaShelly Bolotin*1, Ernesto Lombos1, Rani Yeung1, AliReza Eshaghi1, ... emergence of adamantine resistance in influenza A (H3N2) [1] andoseltamivir resistance in influenza A (H1N1) [2] hasnecessitated the use of methodologies that allow for rapid influenza sub-type analysis....
- 3
- 246
- 0
Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx
... protein, lacking the copper binding domain is cap-able of domain swapping and forms a dimer as revealedby crystal structure analysis [36]. In our case, SEC datacollected for samples at pH 7 have ... nm.AcknowledgementsWe thank Louise Kroon Zˇitko and Manca Kenig for cloning and isolating the recombinant proteins. Wealso are grateful to Sabina Rabzelj and Sasˇ a JenkoKokalj for performing certain SEC ... versa were made in an enclosedreaction cell maintained at a constant temperature. The instrument measured the heat generated or absorbed as the ligand-macromolecule reaction occured. A binding...
- 14
- 586
- 0
Tài liệu Báo cáo khoa học: "An Information-Theory-Based Feature Type Analysis for the Modelling of Statistical Parsing" docx
... decision-treemodels for parsing. In Proceedings of the 33thAnnual Meeting of the ACL.Mitchell P. Marcus, Beatrice Santorini & Mary AnnMarcinkiewicz. 1993. Building a large annotatedcorpus of English: the ... Predictive information redundancy can beused as a measure of the redundancy between the predictive information of a feature type andthat of a feature type combination. Predictive Information Summation ... isknown, it indicates that the feature type graspssome of the important information for the predicted event. According to the above idea, we build the information-theory-based feature type analysismodel,...
- 8
- 503
- 0
Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt
... 504TTCCCCCTGAAGCAGGTGAAGGTGCCCGTCGTGGAGAACAGTGTCTGTGACAGGAAGTACCACTCTGGCCTG 576TCCACAGGGGACAACGTCCCCATCGTGCGGGAGGACATGCTGTGTGCTGGGGACAGCGGGAGGAACTTCTGC 648CAGGGCGACTCTGGAGGGCCCCTGGTCTGCAAGGTGAATGGCACCTGGCTGCAGGCGGGGGTGGTCAGCTGG ... 144CGGTACTGGAGGCACCACTGCGGGGGCTCCCTGATCCACCCCCAGTGGGTGCTGACCGCAGCCCACTGCGTC 216GGACCGGAAGTCCATGGCCCCTCATACTTCAGGGTGCAGCTGCGGGAGCAGCACCTGTATTACCAGGACCAG 288CTGCTGCCCATCAGCAGGATCATCCCCCACCCCAACTGCTACAGCGTTAAGAACGGGGCGGACATCGCCCTG ... (142)TTCCCCCTGAAGCAGGTGAAGGTGCCCGTCGTGGAGAACAGTGTCTGTGACAGGAAGTACCACTCTGGCCTG 576 F P L K Q V K V P V V E N S V C D R K Y H S G L (166)TCCACAGGGGACAACGTATCCATAGTGCAGGAGGATAACTTGTGTGCTGGGGACAGCGGGAGGGACTCCTGC...
- 11
- 527
- 0
Báo cáo khoa học: Direct CIII–HflB interaction is responsible for the inhibition of the HflB (FtsH)-mediated proteolysis of Escherichia coli r32 by kCIII docx
... was achieved. As in the case of CII [10,11],CIII appears to work as an inhibitor for the proteoly-sis of r32through direct interaction with the protease,characterized by a lack of interaction ... (1988) The role of the Escherichia coli DnaK and DnaJ heat shock pro-teins in the initiation of bacteriophage k DNA replica-tion. Proc Natl Acad Sci USA 85, 6632–6636.30 Johnson C, Chandrasekhar ... Halder et al. [11].Purification of proteins and peptidesPurification of r32was carried out according to Chattopad-hyay and Roy [32] and Sambrook et al. [33]. The NUT-21strain containing pUHE...
- 6
- 453
- 0
Báo cáo khoa học: Weak organic acid stress inhibits aromatic amino acid uptake by yeast, causing a strong influence of amino acid auxotrophies on the phenotypes of membrane transporter mutants ppt
... presence of weak organicacid preservatives is an important cause of food spoilage.Many of the determinants of acetate resistance in Sac-charomyces cerevisiae differ from the determinants of resistance ... transketolase reac-tion [19]. Weak acid stress in yeast is acting in a fundament-ally different way. It is not generating an auxotrophy for aromatic amino acids in wild-type cells, but rather ... Pdr12p.Overexpression of Tat2p increases sorbate resistance,but only in trpmutant backgrounds The above data reveals that a requirement for uptake of aromatic amino acids from the culture medium leads tounusually...
- 7
- 391
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP