Báo cáo y học: "Development and Validation of a HPV-32 Specific PCR Assay" pps
Báo cáo y học: "Development and Validation of a HPV-32 Specific PCR Assay" pps
... Developed and ran the HPV-32 specific PCR assay,did all statistical analysis, and prepared the manu-script.NH: Extracted the clinical samples and tested themvia the PGMY and HPV-32 dot blot assay. ... HPV-32 specific PCR assay has a sensitivity of 95.8% and 88.9% by sample and subject,respectively, and specificity was 87.8% and 58.8% by sample and subject, respectively. The lowsensitivity is ... positive samples were identified that were neg-ative by the dot blot assay. The HPV-32 type specific PCR assay has a sensitivity of 95.8% and a specificity of 87.8%with a kappa of 0.32 ± 0.029 as...
- 7
- 424
- 0
Báo cáo y học: " Development and validation of a complementary map to enhance the existing 1998 to 2008 Abbreviated Injury Scale map" doc
... Palmer et al.: Development and validation of a complementary map to enhance the existing 1998 to 2008 AbbreviatedInjury Scale map. Scandinavian Journal of Trauma, Resuscitation and Emergency ... of tra uma against current trau mamanagement standards requires that data be converted(’mapped’) to AIS08. The goal of mapping AIS98-codeddata to AIS08 is to produce an accurate estimate of ... cameron.palmer@rch.org.au1Trauma Service, The Royal Children’s Hospital Melbourne, AustraliaFull list of author information is available at the end of the articlePalmer et al. Scandinavian Journal of Trauma,...
- 13
- 688
- 0
Báo cáo y học: "Development and validation of the self-administered Fibromyalgia Assessment Status: a disease-specific composite measure for evaluating treatment effect" pptx
... greater sensitivity butlower specificity, whereas a cut-off value of 4.6 gave a sensi-tivity of 58.7% with a specificity of 91.9%.Reliability analysisThe reliability of the FAS index was evaluated ... non-ran-domised primary care sample. It can be assumed that the moti-vation of patients who volunteer to take part in a study isdifferent from that of a random population, and they may have a ... women and 17 men)with a mean age of 52.1 ± 10.8 years (range 20 to 75), a meanduration of symptoms of 10.5 ± 9.7 years (range 1 to 28), a mean TPS of 15.1 ± 2.4 (range 11 to 18), and a mean painArthritis...
- 12
- 423
- 0
Báo cáo y học: "Development and validation of an ELISA using a protein encoded by ORF2 antigenic domain of porcine circovirus type 2" ppsx
... a median value of 31.74%. These data showed that the assay was repeatable and yielded a low and acceptable variation.Evaluation of assay specificity and sensitivityThe PCV2 GST-ORF2-E ELISA ... Laboratory of Veterinary Etiological Biology, Key Laboratory of Animal Virology of Ministry of Agriculture, Lanzhou Veterinary ResearchInstitute, Chinese Academy of Agricultural Sciences, Xujiaping ... contrast, enzyme linked immu nosorbentassay (ELISA) can decrease the potential bias that mayoccur with IFA and IPMA and is amenable to automa-tion, so it is suitable for large-scale diagnostics.Recently,...
- 7
- 420
- 0
Báo cáo y học: "Development and validation of molecular markers for characterization of Boehmeria nivea var. nivea and Boehmeria nivea var. tenacissima" pps
... Sn-S62 -a CGACAGTAAACATAAAAACCG 1 1*Sn-S62-b CTGTTACCATTGGCTCTTTACCCAPS 60-67 CP-S62-f TCGTGCGGGTCATAGTACCCCGAGACAAGAGGCCAAAA 2 0.25, 0.3(Afl III)CP-S62-r TGTAATACGAAAGTTTAAGTCTCTTTTCTTAGTC 0.2, ... CTCTTGAGCAATCCAAATGTTTTGTTATCASR-S343-R1 CATAAATCACTTTATAACATAACGAGCTCGTATT 1 1.03SR-S343-R2 CGCGACAGAGGGGTTTTCTTTCTATTA 1 0.95SR-S343-R3 AGACGCCTCACTTTGATAGACATGAGTTTA 1 0.89SNP 50-60 Sn-S62 -a ... F1/R3R2nivea var. veaB. nivea var. tenacissima B. nivea var. niveaCd TC NC CY1 CY2 HCd TC NCFigure 2 SCAR band patterns of B. nivea var. te nacissima and B. nivea var. nivea. SCAR profiles of...
- 9
- 352
- 0
báo cáo hóa học: " Development and validation of a preference based measure derived from the Cambridge Pulmonary Hypertension Outcome Review (CAMPHOR) for use in cost utility analyses" doc
... JRdesigned and managed the valuation survey, conductedanalysis and reported on the valuation exercise. *DM ranthe analysis to identify items for the valuation exercise,analysed the validation data and ... writ-ing of the manuscript. JB designed and managed the valu-ation survey, analysed and reported on the valuation data and contributed to the writing of the manuscript. Allauthors read and approved ... respectively.Table 5 presents examples comparing the predicted valuesaccording to each model and the actual values for eachhealth state. Validation of the preference based CAMPHOR scale A majority...
- 8
- 590
- 0
báo cáo hóa học: " Development and validation of a French patient-based health-related quality of life instrument in kidney transplant: the ReTransQoL" pot
... Fujisawa M, Ichikawa Y, Yoshiya K, Isotani S, Higuchi A, Nagano S,Arakawa S, Hamami G, Matsumoto O, Kamidono S: Assessment of health-related quality of life in renal transplant and hemodi-alysis ... Ortega F, Baltar JM, Díaz-Corte C, Navascués RA, NavesM, Ure a A, Bad a X, Alvarez-Ude F, Alvarez-Grande J: Healthrelated quality of life (HRQOL) of kidney transplantedpatients : variables that ... Berland2 and Roland Sambuc1Address: 1Department of Public Health, EA 3279, University of Aix-Marseille II, France and 2Department of Nephrology and Kidney Transplantation, Hospital Conception,...
- 12
- 520
- 0
Báo cáo hóa học: " Development and validation of a Greek language version of the Manchester Foot Pain and Disability Index" docx
... citation purposes)Health and Quality of Life OutcomesOpen AccessResearchDevelopment and validation of a Greek language version of the Manchester Foot Pain and Disability IndexPatricia Kaoulla1, ... in a pop-ulation-based survey of foot pain [13] as an outcomemeasure in a clinical trial [14] and as a measure of footpain in people with Ehlers-Danlos syndrome [15] and early rheumatoid arthritis ... and validation of a questionnaire designed to measure foot-health status. J Am Podiatr Med Assoc 1998, 88:419-428.11. Garrow AP, Papageorgiou AC, Silman AJ, Thomas E, Jayson MIV, Mac-farlane...
- 9
- 481
- 0
báo cáo hóa học:" Development and validation of a psychosocial screening instrument for cancer" potx
... Canada and 3Health Care and Epidemiology, University of British Columbia, CanadaEmail: Wolfgang Linden* - wlinden@psych.ubc.ca; Dahyun Yi - dyi@hotmail.com; Maria Cristina Barroetavena - mbarroet@bccancer.bc.ca; ... evidence of validity. Finally, raw means and standard deviations are provided for each cancer type and each gender group (Table 4). This presentationalapproach appeared more parsimonious and provided ... highly disease -specific measure because many distress-ing physical aspects of cancer (like pain and functionallimitations) are only salient in late stage cancer and are,fortunately, of limited...
- 7
- 463
- 0
Báo cáo y học: " Development and evaluation of a tool for the assessment of footwear characteristics" pdf
... range of each measure across included footwear was alsoreported. Intra-rater and inter-rater reliability for all cate-gorical data was evaluated using percentage agreement, and kappa (κ) statistics ... Inter-rater reliability for categorical measures.% agreement KappaVariable Day 1 Day 2 Day 1 Day 2FitAdequate length (palpation) 88 83 0.59 0.66Adequate length (straw method) 97 90 0.93 0.79Adequate ... mid-soles, lateral and medial midsole hardness items werecombined for data analysis. Intra-rater and inter-rater reli-ability for all continuous data were evaluated using intra-class correlation...
- 12
- 379
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyendevelopment and use of a risk reference frameworkBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ