0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Báo cáo khoa học:" The interaction between the measles virus nucleoprotein and the Interferon Regulator Factor 3 relies on a specific cellular environment" pdf

Báo cáo khoa học:

Báo cáo khoa học:" The interaction between the measles virus nucleoprotein and the Interferon Regulator Factor 3 relies on a specific cellular environment" pdf

... citation purposes)Virology JournalOpen AccessResearch The interaction between the measles virus nucleoprotein and the Interferon Regulator Factor 3 relies on a specific cellular environmentMatteo ... usingforward 5'-CATGAATTCATGGGAACCCCAAAGCCA -3& apos; and backward 5'-TGACTCGAGTCAGCTCTCCCCAG-GGCC -3& apos; primers containing EcoRI and XhoI restrictionsites (bold), respectively. The cDNA ... transacti-vator of the cellular innate immune response [25]. Itbelongs to the family of interferon regulatory factors (IRF) and acts as a transactivator for the interferon- β (IFN-β) and various...
  • 17
  • 308
  • 0
Tài liệu Báo cáo khoa học: Functional interaction between RNA helicase II⁄Gua and ribosomal protein L4 pptx

Tài liệu Báo cáo khoa học: Functional interaction between RNA helicase II⁄Gua and ribosomal protein L4 pptx

... ATGGCCTCAGTTCCGAAAACCAACAAAATAGA Northern blot analysis probe, for 18S rRNAYH11 TTCTGACTTAGAGGCGTTCAGTCATAATCCCA Northern blot analysis probe, for 28S rRNAH. Yang et al. Gua–RPL4 interaction ... underExperimental procedures.H. Yang et al. Gua–RPL4 interaction in mammalian rRNA productionFEBS Journal 272 (2005) 37 88 38 02 ª 2005 FEBS 37 95 33 Ueno M, Nakayama H, Kajikawa S, Katayama K,Suzuki K & ... (amino acids 131 –264) and M3(amino acids 131 33 3) mutants to the nucleolus are inaccordance with the finding that both NLS and NoLSare within amino acids 131 –264. Mutant M1 (aminoacids 131 –196)...
  • 15
  • 433
  • 0
Tài liệu Báo cáo khoa học: Loose interaction between glyceraldehyde-3-phosphate dehydrogenase and phosphoglycerate kinase revealed by fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy in living cells doc

Tài liệu Báo cáo khoa học: Loose interaction between glyceraldehyde-3-phosphate dehydrogenase and phosphoglycerate kinase revealed by fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy in living cells doc

... phPGK1–5aa–cerulean wereconstructed using the primers 5¢-CCGGA ATTCCAATGT CGCTT TCTAA CAAGC T -3 and 5¢-GGCGGATCCA TAATA TTGCT GAGAG CATCC A -3 , and 5¢-CCGGA ATTCC AATGT CGCTT TCTAA CAAGC T -3 and ... and 5¢-CGGAA TTCCG ATGGG GAAGG TGAAG GTCGG -3 , and 5¢-CGGAA TTCCG ATGGG GAAGG TGAAG GTCGG -3 and 5¢-CGACC GGTGT CTCCT TGGAG GCCAT GTGGG -3 , respectively, and pcitrine-N1.phPGK1–7aa–cerulean and ... shown in the FLIMimages (Fig. 3A, C) and in Table 2. On the other hand, the lifetimes of PGK–7aa–cerulean and their intracellu-lar distribution remained unchanged when GAPDH–7aa–citrine was coexpressed...
  • 9
  • 586
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Ranking Algorithms for Named–Entity Extraction: Boosting and the Voted Perceptron" pdf

... the same as , but hasan additional flag appended. The flag indi-cates whether or not the word appears in a dic-tionary of words which appeared more oftenlower-cased than capitalized in a large ... consecutive character types arenot repeated in the mapped string. For example, An-imal would be mapped to Aa, G.M. would again bemapped to A. A The tagger was applied and trained in the sameway ... 1-1 -A. The word with each character mapped to its. For example, G.M. would be mapped to A. A., and Animal would be mapped to Aaaaaa. The word with each character mapped to itstype, but repeated...
  • 8
  • 387
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Discriminative Language Modeling with Conditional Random Fields and the Perceptron Algorithm" pptx

... yi. The features in the model are up-dated, and the algorithm moves to the next utterance.After each pass over the training data, performance on a held-out data set is evaluated, and the parameterizationwith ... discriminative language modelingfor a large vocabulary speech recognition task. We con-trast two parameter estimation methods: the perceptronalgorithm, and a method based on conditional randomfields ... what effect each parame-ter has on the error rate, and then modifies the parametersto reduce the error rate based on this prediction.2 Linear Models, the PerceptronAlgorithm, and Conditional...
  • 8
  • 458
  • 0
Báo cáo khoa học: Direct interaction between CD91 and C1q docx

Báo cáo khoa học: Direct interaction between CD91 and C1q docx

... and C1q. The interaction was investigatedusing various protein interaction assays. A direct interaction between puri-fied C1q and CD91 was observed both by ELISA and a surface plasmonresonance ... a physiological salt concentration (0.15 m NaCl), the interaction was time-dependent, saturable and fast,being detectable after only a few minutes of incubation.By contrast, increasing the NaCl concentration ... human blood cells, confirming a mono-cyte interaction. The interaction between C1q and PBMCs could be partially inhibited by RAP and solu-ble CD91. The interaction between C1q and CD91was also...
  • 12
  • 529
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Preimplant factors affecting postimplant CTdetermined prostate volume and the CT/TRUS volume ratio after transperineal interstitial prostate brachytherapy with 125I free seeds" pps

... performed the statistical analysis and drafted the manuscript, and oversaw the project completion. EK, HN, and HA participated in preparing ofdata acquisiti on. MO and NS contributed to data analysis. ... by a single radiation oncologist (AS). The plan-ning target volume included the prostate gland, with a margin of 3 mm anteriorly and laterally and 5 mm in the cranial and caudal direc tions. ... in the timing of postimplant CT scans among these studies. In the studies by Badiozamani and colleagues and Tanaka and colleagues, the postimplant CT scans were obtained the day after implantation,...
  • 6
  • 264
  • 0
báo cáo khoa học:

báo cáo khoa học: "Genetic relationship between prepuberal plasma FSH levels and reproductive performance in Lacaune ewe lambs" docx

... variation caused by several factors in hormonalvariables (FSH and its logarithm transformation) and in fertility and litter size.. - For FSH, the variance analysis was conducted ... correlation was observed beetwenplasma FSH concentration at 5 weeks of age and that observed at 3 and 7 weeks and, (2) at 5 weeks of age the highest values were acheived ... as the result of inseminations made from 33 sires in 30 flocks.These flocks are part of a Lacaune meat selection scheme aimed at increasing prolifi-cacy and operating...
  • 9
  • 258
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdflam the nao de tom tat bao cáo khoa hocbáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcchuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM