Báo cáo khoa học: " JC virus in the pathogenesis of colorectal cancer, an etiological agent or another component in a multistep process?" pdf
Báo cáo khoa học: " JC virus in the pathogenesis of colorectal cancer, an etiological agent or another component in a multistep process?" pdf
... 7:42http://www.virologyj.com/content/7/1/42Page 2 of 8HYPOTHESIS Open Access JC virus in the pathogenesis of colorectal cancer, an etiological agent or another component in a multistep process?Tatiana R Coelho1, Luis Almeida1, ... diseases are acquiring relevance as impor-tant pathogenic elements in human cancer, since almostone fifth of human cancers are associated with infec-tious agent, either bacteria or viruses, particularly ... particularstrains more strongly associated to carcinomas.JCV DNA in normal, benign and malignant colorectal lesionsJCV DNA sequences and proteins have been detected in a broad range of human tumors of...
- 8
- 400
- 0
báo cáo khoa học: "Capillary electrophoresis for the characterization of quantum dots after non-selective or selective bioconjugation with antibodies for immunoassay" docx
... popu-lar in the labeling of glycoproteins. Taking advantage of the polysaccharide chains within the Fc region of an anti-body, it can allow bioconjugation to occur relatively faraway from the antigen ... the laboratory. Both authors designed and coordinated exper-iments. EPCL provided important advice and financialsupport. MP wrote manuscript. Both authors read andapproved final manuscript.AcknowledgementsFinancial ... fluorescent nanoparticles thatreceive increasing recognition as a viable alternative (toconventional organic fluorophores) for molecular labe-ling. Their quantum mechanical and electronic character-istics...
- 15
- 301
- 0
Tài liệu Báo cáo khoa học: cN-crystallin and the evolution of the bc-crystallin superfamily in vertebrates pdf
... use of animals complied with the ARVO Statementfor the Use of Animals in Ophthalmic and Vision Researchand the Intramural Animal Care and Use program of the National Institutes of Health (NIH).G. ... protein implicated in the control of malignancy in melanoma in man [8,9]. In the verteb-rate lens, the b and c crystallins together account for the majority of the soluble proteins (the other majorfamily ... during mam-malian evolution. These changes illustrate the way in which gene families may expand, contract and adapt.They may also help us understand the functions of the c-crystallin family in...
- 16
- 561
- 0
Báo cáo khoa học: Limited mutagenesis increases the stability of human carboxypeptidase U (TAFIa) and demonstrates the importance of CPU stability over proCPU concentration in down-regulating fibrinolysis doc
... substrates, and determined the Kmconstants of native CPU from plasma, recom-binant WT CPU and YQ CPU for Hip-Arg and bra-dykinin using an arginine kinase-based kinetic assay[27]. Data are presented ... Biosciences. We thankMarie Karlsson, Patrik Ho¨jman, Daniel Herrlander,Al a Khairullina and Yani Sim for excellent technicalassistance and Fritz Schweikart for performing the N-terminal amino acid sequencing. ... (tgctctagagcggccgcgggatgaagctttgcagccttgcagtccttgtacc); reverse: C-HIS1-rev (atgatgatgcttatcgtcatcgtccccgggctcgagaacattcctaatga catgccaagc) and C-HIS2rev (cggggtaccttattaagatccactatgatgatgatgatgatgatgatgct tatcgtcatcgtcc).The...
- 15
- 397
- 0
Báo cáo khoa học: New evidence for the role of calcium in the glycosidase reaction of GH43 arabinanases pot
... a- l-1,2-, a- l-1,3-and a- l-1,5-arabinosyl residues from various oligosac-charides and polysaccharides, including arabinan, ara-binoxylan and arabinogalactan [6,7]. ABNs attack the glycosidic bonds of ... residues, each of them was inde-pendently substituted by an alanine. The arabinanaseactivity of the mutants D3 8A, D17 1A and E22 4A wasassayed in an Escherichia coli periplasmic fraction andcompared ... located in blades IVand V and the C-terminal domain or between the hair-pin that joins blades IV and V and the C-terminaldomain (Fig. 1 and Table S1). The apolar interactions in the interface...
- 13
- 568
- 0
Báo cáo khoa học: Thyroid hormone induces the expression of 4-1BB and activation of caspases in a thyroid hormone receptor-dependent manner pptx
... designated HeLaTR/4-1BB and HeaLaTR/TRAF1, respectively. Primers for amplifying the 4-1BB andTRAF1 cDNAs were: 5¢-GAATTCAAGCTTATGGGAAACAGCTGTTACAACATA-3¢ and 5¢-GAATTCAAGCTTCACAGTTCACATCCTCCTTCTTCT-3¢ ... used for amplifying the hTRa1cDNA were: 5¢-CCCGGGAAGCTTCGGACCATGGAACAGAAGCCAAGCAAGGTG-3¢ and 5¢-CCCGGGGTCGACGACTTCCTGATCCTCAAAGACCTC-3¢ .In order to overexpress 4-1BB and TRAF1 in the HeLaTRcells, ... 000Correspondence to H. Okabe, Pharmaceutical ResearchDepartment 4, Kamakura Research Laboratories,Chugai Pharmaceutical Co. Ltd, 200 Kajiwara, Kamakura,Kanagawa, 247-8530, Japan.Fax: +...
- 10
- 491
- 0
Báo cáo khoa học: Determining and understanding the control of glycolysis in fast-growth tumor cells Flux control by an over-expressed but strongly product-inhibited hexokinase pdf
... profile of human phospho-fructokinase during malignant transformation in vivoand in vitro: transformation-and progression-linked dis-criminants of malignancy. Cancer Res 45, 2993–3001.17 Sa´nchez-Martı´nez ... Mexico guidelines in accordance with the Declaration of Helsinki and the US NIH guidelines for careand use of experimental animals.Determination of steady-state concentrations of metabolitesCells ... to the mit-ochondrial inner membrane and another in the cytosol,which regulate the cytosolic NADH ⁄ NAD+ratio andare involved in the synthesis of triacylglycerols [50]. The activity of the...
- 14
- 510
- 0
Báo cáo khoa học: Preliminary Report on the Insertion of English Articles in RussianEnglish MT Output"" pdf
... altering in any simply statable way the intuitive meaning of the passage. In: "He is working on —— analysis of English verbs." we may read an, the, or Ø, with appropriate intonations, and ... clues, the human translator can only make an educated guess, and the machine, with its drastically limited set of potential determiners, cannot do better. Rut another kind of ambiguity arises ... and each was classified intuitively as a member of one of the five article-pattern classes. Once again the first half of the corpus was tested, and again no unacceptable results were obtained....
- 3
- 423
- 0
Báo cáo khoa học: "Mucin pattern reflects the origin of the adenocarcinoma in Barrett''''s esophagus: a retrospective clinical and laboratorial study" ppsx
... the pathologists and involved in laboratory investi-gation. AVSR was involved in collecting data, laboratoryinvestigation, carried out the immunoassays. All authorsread and approved the final ... epithelium adjacent to the tumors. Therewas an association between the predominance of mucinexpressed in the adjacent epithelium and the pattern of mucin expression in the tumors, may indicating ... same pattern already described for incom-plete intestinal metaplasia of the stomach, and is furtherevidence that BE and incomplete intestinal metaplasia of the stomach are the same condition and...
- 8
- 410
- 0
báo cáo khoa học: " Pilot study evaluating the effects of an intervention to enhance culturally appropriate hypertension education among healthcare providers in a primary care setting" pdf
... shows the mean scores of the respondents of the intervention and control groups and the results of the ANOVA analysis on each of the four scales at T0 and atT1. At baseline, no significant differences ... JM analysed the data in dialogue with PB, JH, and KS. EB and JHwrote the paper. PB, JM, and KS commented on various draft versions of the manuscript. All authors read and approved the final manuscript.Table ... Please explain.FinanceAre there any issues related to your financial situation that make it difficult for you to manage hypertension? Please explain.1Based on Kleinman's Explanatory...
- 10
- 440
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015