0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: " Characterization and frequency of a newly identified HIV-1 BF1 intersubtype circulating recombinant form in São Paulo, Brazil" ppt

Báo cáo y học:

Báo cáo y học: " Characterization and frequency of a newly identified HIV-1 BF1 intersubtype circulating recombinant form in São Paulo, Brazil" ppt

... 270:988-991.doi:10.1186/1743-422X-7-74Cite this article as: Sanabani et al.: Characterization and frequency of a newly identified HIV-1 BF1 intersubtype circulating recombinant form in São Paulo, Brazil. Virology Journal 2010 7:74.Submit ... frequency of a newly identified HIV-1 BF1 intersubtype circulating recombinant form in São Paulo, BrazilSabri Saeed Sanabani1,2*, Évelyn Regina de Souza Pastena1,2, Walter Kleine Neto1, Vanessa ... CRF46 _BF1 accounts for 0.56% of the HIV-1 circulating strains in São Paulo.Identification of Related HIV-1 Strains in the database A search for similar recombination patterns in a sequence database...
  • 12
  • 301
  • 0
Tài liệu Báo cáo Y học: Characterization and regulation of yeast Ca2+-dependent phosphatidylethanolamine-phospholipase D activity docx

Tài liệu Báo cáo Y học: Characterization and regulation of yeast Ca2+-dependent phosphatidylethanolamine-phospholipase D activity docx

... amino acid-rich media included: YPD [yeast extract and Bactopeptone(YP) containing 2% dextrose]; YPA (YP containing 0.05%glucose and 2% potassium acetate); and YPG (YPcontaining 3.5% galactose).Phospholipase ... phosphatidylserine and does notcatalyse a transphosphatidylation with primary short-chainalcohols. We have characterized the cytosolic and mem-brane-bound forms of the yeast PtdEtn-PLD and examinedthe ... is biphasic.This pattern raises the possibility that Ca2+may have a dualmechanism of action in activating PtdEtn-PLD, e.g. Ca2+may participate in catalysis as well as facilitate enzyme–substrate...
  • 10
  • 499
  • 0
Báo cáo y học:

Báo cáo y học: "Characterization and modeling of the Haemophilus influenzae core and supragenomes based on the complete genomic sequences of Rd and 12 clinical nontypeable strain" potx

... valuable discussions and data check-ing; Alice Erwin and Arnold Smith of the Seattle Biomedical Research Insti-tute and Maynard V Olson, Rajinder K Kaul and Yang Zhou of theUniversity of Washington ... shared genes that are unique to that pair of strains. A typical pair of strains differs by 395 genes. Similar pairs of strains are shaded in yellow, while divergent strains are shaded orange.86028 ... complement of genes available to a patho-genic bacterial species exists in a 'supragenome' pool that isnot contained by any particular strain, but is availablethrough a genically diverse...
  • 18
  • 508
  • 0
Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt

Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt

... CTGCTGTAATAATGGGTAGAAGGARA439 GGAATTCCATATGCGTATTATGGCCAGARA440 TATTTACTCGAGAATCCCCTCCTCAGCARA444 CGGGATCCACCGTGAAAAAGAAAGAATTGTCARA451 GAATTCATAAAGAAGCTTTGTCTGAAGCARA456 CGGCGCGTCATATGGCCAGTCATGATAARA457 ... ATG ACT GGARA514 TAATACGCATTTGCTC CGT GTT TTC GTC ATA AAA TAA AAC GCT TTC AAA TACARA515 GTATTTGAAAGCGTTTTATTTTATGACGAA AAC ACG GAG CAA ATG CGT ATT A L. M. Godinho and I. de Sa´-Nogueira AraL ... CGTGAATTCACCGAGCATGTCACCAAAGCCARA477 AATCAGAATGGGATCCGGTGAARA486 CGGCTGACATTCTGATTGACTTGGACGGARA487 CAATCAGAATGTCAGCCGGTGACACAGGARA509 CC AGT CAT GAT A AG CCT GTG TCA CCGARA510 CGG TGA CAC AGG CTT ATC ATG...
  • 14
  • 594
  • 0
Báo cáo y học:

Báo cáo y học: "Costs and effects of paliperidone extended release compared with alternative oral antipsychotic agents in patients with schizophrenia in Greece: A cost effectiveness study" pdf

... therapeutic area of schizophrenia isvast and growing rapidly, and was helpful in developing a solid and definitive model. Information that was notavailable in the literature was obtained from clinicalexpert ... stable day in the case of -10% of frequency of relapses and €2.42 per stable day in the case of -10% of the duration of relapses), even in the event of a 10% decrease of the frequency and duration of ... Harrigan EP, Laksh-minarayanan M: Ziprasidone 80 mg/day and 160 mg/day in theAnnals of General Psychiatry 2008, 7:16 http://www.annals-general-psychiatry.com/content/7/1/16Page 3 of 12(page...
  • 12
  • 479
  • 0
Báo cáo y học:

Báo cáo y học: "Costs and effects of paliperidone extended release compared with alternative oral antipsychotic agents in patients with schizophrenia in Greece: a cost effectiveness study" ppsx

... schizophrenia in Greece: a costeffectiveness study. Annals of General Psychiatry 2008, 7:16.Table 1: Mean annual number of stable days and cost per patient by pharmaceutical treatment.Paliperidone ... Kousoulakou H, Ollandezos M, Athanasakis K, Papanico-laou S, Kyriopoulos I: Costs and effects of paliperidoneextended release compared with alternative oral antipsy-chotic agents in patients with ... PubMed and archived on PubMed Central yours — you keep the copyrightSubmit your manuscript here:http://www.biomedcentral.com/info/publishing_adv.aspBioMedcentralAnnals of General Psychiatry 2009,...
  • 2
  • 372
  • 0
Báo cáo y học:

Báo cáo y học: " Safety and efficacy of a generic fixed-dose combination of stavudine, lamivudine and nevirapine antiretroviral therapy between HIV-infected patients with baseline CD4 " pot

... Sirirat Likanonsakul1 and Somnuek Sungkanuparph2Address: 1Bamrasnaradura Infectious Diseases Institute, Ministry of Public Health, Nonthaburi, 11000, Thailand and 2Faculty of Medicine Ramathibodi ... study and statisticalanalysis. SC participated in the design of the study. SL par-ticipated in the design of the study. SS participated in thedesign of the study and statistical analysis.AcknowledgementsThe ... Intention-to-treat analysis ** On-treatment analysisBioMed CentralPage 1 of 8(page number not for citation purposes)AIDS Research and TherapyOpen AccessResearchSafety and efficacy of a...
  • 8
  • 371
  • 0
Báo cáo y học:

Báo cáo y học: " Development and evaluation of a tool for the assessment of footwear characteristics" pdf

... range of each measure across included footwear was alsoreported. Intra-rater and inter-rater reliability for all cate-gorical data was evaluated using percentage agreement, and kappa (κ) statistics ... mid-soles, lateral and medial midsole hardness items werecombined for data analysis. Intra-rater and inter-rater reli-ability for all continuous data were evaluated using intra-class correlation ... by 1 – 3 weeks) by a physiotherapist and a podiatrist on each participant's dominantfoot. Intra-rater and inter-rater reliability were evaluated using intra-class correlation coefficients(ICCs)...
  • 12
  • 379
  • 0
Báo cáo y học:

Báo cáo y học: "Catheterization and embolization of a replaced left hepatic artery via the right gastric artery through the anastomosis: a case report" pdf

... of extrahepatic arterial blood supply to the liver duringhepatic arterial infusion chemotherapy. Eur Radiol 1998, 8:1613-1618.3. Tanaka T, Arai Y, Inaba Y, Matsueda K, Aramaki T, Takeuchi Y, ... retrograde catheterization of the right gastric artery via theleft gastric artery. J Vasc Interv Radiol 2001, 12:1103-1106.9. Inaba Y, Arai Y, Matsueda K, Takeuchi Y, Aramaki T: Right gastric arteryembolization ... Kichikawa K:Radiologic placement of side-hole catheter with tip fixation for hepaticarterial infusion chemotherapy. J Vasc Interv Radiol 2003, 14:63-68.4. Arai Y, Takeuchi Y, Inaba Y, Yamaura...
  • 4
  • 291
  • 1
Báo cáo y học:

Báo cáo y học: " Development and evaluation of an immunochromatographic strip test based on the recombinant UL51 protein for detecting antibody against duck enteritis virus" ppsx

... China (No.706050).Author details1Avian Diseases Research Center, College of Veterinary Medicine of SichuanAgricultural University, Ya’an, Sichuan, 625014, China.2Key Laboratory of Animal ... (LB) agar medium containing 50μg/mL kanamycin, and were incubated overnight at 37°C. 200 m L LB medium containing 50 μg/mL kanamycinwas inoculated with a freshly grown colony containingthe ... bacter-ial cells containing the recombinant UL51 protein wereharvest. The recombinant protein obtained was ana-lyzed by SDS-PAGE and western blotting. Coomassieblue staining showed that the...
  • 8
  • 349
  • 0

Xem thêm

Từ khóa: Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ